Incidental Mutation 'R4606:Myof'
ID 346054
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms Fer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 041817-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4606 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 37899036-38043577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37967099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 526 (V526M)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect probably damaging
Transcript: ENSMUST00000041475
AA Change: V526M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: V526M

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172095
AA Change: V526M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: V526M

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223650
Predicted Effect probably damaging
Transcript: ENSMUST00000225159
AA Change: V10M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226068
AA Change: V539M

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Abcb5 T C 12: 118,932,610 probably null Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Muc19 C T 15: 91,934,383 noncoding transcript Het
Myadm T A 7: 3,297,400 L226* probably null Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pik3r2 G A 8: 70,772,136 R199* probably null Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Pou3f1 A T 4: 124,658,836 E377V probably damaging Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Ptprz1 C T 6: 23,001,487 P1192L possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
R8116:Myof UTSW 19 37932719 missense probably damaging 0.99
R8264:Myof UTSW 19 37921433 missense probably damaging 1.00
R8415:Myof UTSW 19 37995424 missense probably benign
R8756:Myof UTSW 19 37939952 missense probably benign
R8777:Myof UTSW 19 37980393 missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37980393 missense probably benign 0.01
R8835:Myof UTSW 19 37967099 missense possibly damaging 0.92
R9046:Myof UTSW 19 37934664 intron probably benign
R9396:Myof UTSW 19 37934846 missense probably damaging 1.00
R9415:Myof UTSW 19 37952964 missense probably damaging 1.00
R9450:Myof UTSW 19 37960926 missense probably damaging 1.00
R9451:Myof UTSW 19 37977648 critical splice donor site probably null
R9537:Myof UTSW 19 37907606 missense probably damaging 1.00
R9592:Myof UTSW 19 38043289 missense probably damaging 0.99
R9616:Myof UTSW 19 37934815 missense possibly damaging 0.52
R9751:Myof UTSW 19 37936370 missense probably benign
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGTTGGAGGGACTTACTATGAAG -3'
(R):5'- AGAGCCTTTTCTATCCGAGC -3'

Sequencing Primer
(F):5'- TGAAGCAGATCTTTCTCCGAG -3'
(R):5'- CGAGCATCTCATGACATCATTTGG -3'
Posted On 2015-09-25