Incidental Mutation 'R4607:Gsg1l'
ID346080
Institutional Source Beutler Lab
Gene Symbol Gsg1l
Ensembl Gene ENSMUSG00000046182
Gene NameGSG1-like
SynonymsC230098I05Rik, G630023A01Rik
MMRRC Submission 041818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4607 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location125878420-126082411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125958549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 136 (I136F)
Ref Sequence ENSEMBL: ENSMUSP00000073591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073935]
Predicted Effect probably damaging
Transcript: ENSMUST00000073935
AA Change: I136F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073591
Gene: ENSMUSG00000046182
AA Change: I136F

DomainStartEndE-ValueType
Pfam:GSG-1 5 122 4.9e-46 PFAM
Pfam:PMP22_Claudin 8 227 8.5e-12 PFAM
Meta Mutation Damage Score 0.3186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 G T 5: 94,383,528 R90S probably benign Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adgra3 A C 5: 49,970,739 V800G probably damaging Het
Aldh1a1 A T 19: 20,621,687 Y154F probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Chrna9 A G 5: 65,976,735 I310V possibly damaging Het
Cpeb3 A G 19: 37,174,839 S46P possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlgap5 A G 14: 47,413,018 I151T possibly damaging Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
Erlin1 C T 19: 44,063,035 V76M probably damaging Het
Fam161a G A 11: 23,020,710 S296N probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm906 G A 13: 50,245,506 T928I possibly damaging Het
Gna14 A G 19: 16,533,711 probably null Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ipo11 A G 13: 106,900,811 S175P probably damaging Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Map3k2 T C 18: 32,199,977 L68P probably damaging Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Mink1 A G 11: 70,606,067 E417G possibly damaging Het
Myrf G T 19: 10,229,067 D29E probably damaging Het
Nelfcd T A 2: 174,423,162 D215E probably benign Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Olfr951 T C 9: 39,394,735 *312Q probably null Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdh9 T A 14: 93,015,573 N1218I probably benign Het
Pcdhga6 A G 18: 37,708,618 N464D probably damaging Het
Rdx T A 9: 52,068,837 S243R probably damaging Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slit1 C A 19: 41,616,793 R873L probably benign Het
Strc T A 2: 121,372,945 I1130F probably benign Het
Tlk2 T A 11: 105,255,018 L350Q probably damaging Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,054 H53Q probably benign Het
Trbv24 T C 6: 41,218,401 probably benign Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp512b C A 2: 181,588,774 R441L probably damaging Het
Other mutations in Gsg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Gsg1l APN 7 125923426 missense possibly damaging 0.81
IGL01873:Gsg1l APN 7 125958443 missense probably damaging 1.00
IGL02148:Gsg1l APN 7 125923499 missense possibly damaging 0.82
IGL03076:Gsg1l APN 7 125923493 missense probably benign 0.03
R0456:Gsg1l UTSW 7 125923510 missense possibly damaging 0.67
R0513:Gsg1l UTSW 7 126020623 critical splice donor site probably null
R1771:Gsg1l UTSW 7 125958573 missense probably damaging 1.00
R1827:Gsg1l UTSW 7 125910197 missense possibly damaging 0.86
R3084:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R3085:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R3086:Gsg1l UTSW 7 125891680 missense probably benign 0.36
R4608:Gsg1l UTSW 7 125958549 missense probably damaging 1.00
R4876:Gsg1l UTSW 7 125891669 missense probably benign 0.04
R6995:Gsg1l UTSW 7 125923486 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGATGCAATAGCCTGTGC -3'
(R):5'- TTTATACCCGCAGTGCCAAC -3'

Sequencing Primer
(F):5'- TCCCCTGGTGCTGAGCAAAAG -3'
(R):5'- ACCTCATCCCACGCTGG -3'
Posted On2015-09-25