Incidental Mutation 'R0254:Col11a2'
ID 34611
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Name collagen, type XI, alpha 2
Synonyms
MMRRC Submission 038485-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R0254 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34258411-34285659 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 34283777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000143354]
AlphaFold Q64739
Predicted Effect unknown
Transcript: ENSMUST00000087497
AA Change: G1522V
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: G1522V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114252
AA Change: G1527V
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: G1527V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114255
AA Change: G1561V
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: G1561V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143354
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144927
Meta Mutation Damage Score 0.2719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,853,902 (GRCm39) M252L probably benign Het
Abca6 A G 11: 110,127,615 (GRCm39) V314A probably benign Het
Abcb1b A T 5: 8,877,409 (GRCm39) E656D probably benign Het
Abhd4 T C 14: 54,500,691 (GRCm39) I160T probably benign Het
Aco2 T C 15: 81,773,557 (GRCm39) V32A probably damaging Het
Actl6b A G 5: 137,552,406 (GRCm39) probably benign Het
Akap13 T C 7: 75,386,352 (GRCm39) probably benign Het
Alpk3 A T 7: 80,726,722 (GRCm39) T136S probably benign Het
Ap1g1 G T 8: 110,529,749 (GRCm39) M56I probably benign Het
Arid2 C T 15: 96,268,452 (GRCm39) T855I probably damaging Het
Asprv1 T C 6: 86,606,077 (GRCm39) F308L probably damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp11b T A 3: 35,866,259 (GRCm39) M378K possibly damaging Het
Atp1a3 T C 7: 24,680,937 (GRCm39) probably benign Het
Blk C A 14: 63,618,253 (GRCm39) A218S probably benign Het
C4b T A 17: 34,953,750 (GRCm39) T953S probably benign Het
Cdadc1 T C 14: 59,813,356 (GRCm39) probably benign Het
Cdca2 C A 14: 67,914,627 (GRCm39) L877F probably damaging Het
Ceacam10 G T 7: 24,477,733 (GRCm39) V83L probably damaging Het
Cep290 A T 10: 100,350,436 (GRCm39) I677F probably benign Het
Clip1 A T 5: 123,755,395 (GRCm39) probably benign Het
Coro1c A T 5: 113,983,313 (GRCm39) V405D probably benign Het
Crebrf A G 17: 26,958,568 (GRCm39) T13A probably benign Het
Cspg4 A G 9: 56,804,694 (GRCm39) E1835G probably damaging Het
Cubn A T 2: 13,480,846 (GRCm39) probably null Het
Cubn T C 2: 13,429,505 (GRCm39) N1332S probably benign Het
Cubn T C 2: 13,445,325 (GRCm39) T1014A possibly damaging Het
Efnb1 T C X: 98,180,634 (GRCm39) probably benign Het
Elf2 G T 3: 51,215,611 (GRCm39) P33Q probably damaging Het
Fap C T 2: 62,333,746 (GRCm39) G633D probably damaging Het
Gm10288 T C 3: 146,544,675 (GRCm39) noncoding transcript Het
Got2 T C 8: 96,596,166 (GRCm39) N318S probably benign Het
Guk1 A T 11: 59,076,854 (GRCm39) F76L probably damaging Het
H2-K2 A T 17: 34,215,639 (GRCm39) probably benign Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hinfp G A 9: 44,209,536 (GRCm39) H250Y probably damaging Het
Hnrnpm C T 17: 33,871,242 (GRCm39) probably null Het
Hsd11b2 T A 8: 106,249,699 (GRCm39) V270E possibly damaging Het
Igbp1b A T 6: 138,635,201 (GRCm39) M81K probably damaging Het
Kif11 A G 19: 37,399,957 (GRCm39) T815A probably benign Het
Kit G A 5: 75,781,581 (GRCm39) V337I probably benign Het
Klf11 T C 12: 24,703,582 (GRCm39) S6P probably damaging Het
Klk13 T C 7: 43,373,245 (GRCm39) V193A probably benign Het
Krt73 T A 15: 101,708,324 (GRCm39) probably benign Het
L1td1 T A 4: 98,625,419 (GRCm39) L538* probably null Het
Macf1 A G 4: 123,326,572 (GRCm39) L2061P probably damaging Het
Mcm2 A G 6: 88,860,998 (GRCm39) I900T probably damaging Het
Med16 A T 10: 79,736,034 (GRCm39) N371K possibly damaging Het
Mepce A C 5: 137,783,698 (GRCm39) D209E possibly damaging Het
Mrc2 C G 11: 105,238,692 (GRCm39) P1249R probably benign Het
Mx2 A T 16: 97,357,295 (GRCm39) I463L probably benign Het
Naaa A T 5: 92,412,994 (GRCm39) N73K probably damaging Het
Nags T A 11: 102,038,771 (GRCm39) L404Q probably damaging Het
Neb A G 2: 52,133,402 (GRCm39) Y3379H probably damaging Het
Nhsl1 A G 10: 18,348,733 (GRCm39) E120G probably damaging Het
Or11j4 T C 14: 50,630,536 (GRCm39) S108P probably damaging Het
Or4f53 A C 2: 111,087,466 (GRCm39) N2T probably benign Het
Or51a42 T C 7: 103,708,728 (GRCm39) H27R probably benign Het
Or51ah3 T A 7: 103,209,829 (GRCm39) Y48* probably null Het
Or51f5 C A 7: 102,424,076 (GRCm39) S115* probably null Het
Pcnt A G 10: 76,228,414 (GRCm39) F1584L probably benign Het
Pdgfra G A 5: 75,328,596 (GRCm39) V243I probably damaging Het
Polr2a T C 11: 69,634,497 (GRCm39) I689V possibly damaging Het
Ppfia4 C A 1: 134,251,962 (GRCm39) probably benign Het
Prmt8 C A 6: 127,688,771 (GRCm39) V200L probably damaging Het
Prpf8 T A 11: 75,397,188 (GRCm39) I2007N possibly damaging Het
Ptpn6 T C 6: 124,705,113 (GRCm39) E230G probably damaging Het
R3hcc1l G A 19: 42,551,587 (GRCm39) V195I probably damaging Het
Rb1cc1 C T 1: 6,333,071 (GRCm39) T1330I probably damaging Het
Reep3 G T 10: 66,857,575 (GRCm39) T172N probably benign Het
Rfwd3 A G 8: 112,020,655 (GRCm39) V236A probably benign Het
Rgs22 T C 15: 36,104,698 (GRCm39) I121V probably damaging Het
Robo1 T A 16: 72,461,058 (GRCm39) F11I probably benign Het
Rsrc2 A G 5: 123,878,910 (GRCm39) probably benign Het
Rubcn A G 16: 32,668,316 (GRCm39) V117A probably benign Het
Scamp1 T G 13: 94,347,088 (GRCm39) N192T probably benign Het
Scn8a T A 15: 100,916,245 (GRCm39) I1218N probably damaging Het
Serinc1 A G 10: 57,399,304 (GRCm39) S200P probably damaging Het
Serpinb9f T A 13: 33,518,574 (GRCm39) F358Y probably damaging Het
Slc12a5 T C 2: 164,839,165 (GRCm39) probably null Het
Slc5a4b T C 10: 75,906,462 (GRCm39) M386V possibly damaging Het
Smarca5 A G 8: 81,431,329 (GRCm39) F963L probably benign Het
Smchd1 A T 17: 71,718,886 (GRCm39) F828I probably benign Het
Smr2l A T 5: 88,430,230 (GRCm39) H42L possibly damaging Het
Stab2 G T 10: 86,733,824 (GRCm39) Q1333K probably benign Het
Svop T C 5: 114,176,600 (GRCm39) S349G probably benign Het
Tdrd1 G A 19: 56,830,998 (GRCm39) S271N probably benign Het
Tec G A 5: 72,941,081 (GRCm39) P159S probably benign Het
Tec T C 5: 72,920,899 (GRCm39) probably benign Het
Tfip11 G A 5: 112,483,521 (GRCm39) M645I probably benign Het
Thap12 A T 7: 98,364,488 (GRCm39) T219S probably benign Het
Tmem87a C T 2: 120,205,988 (GRCm39) R329H probably damaging Het
Tpsab1 A G 17: 25,562,719 (GRCm39) Y227H probably damaging Het
Urah G A 7: 140,417,602 (GRCm39) V114I probably benign Het
Wnt5a G A 14: 28,244,811 (GRCm39) E353K probably damaging Het
Zfp1004 G A 2: 150,033,784 (GRCm39) R35K possibly damaging Het
Zfp101 A T 17: 33,599,952 (GRCm39) H601Q possibly damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34,280,254 (GRCm39) unclassified probably benign
IGL01839:Col11a2 APN 17 34,283,056 (GRCm39) unclassified probably benign
IGL02429:Col11a2 APN 17 34,261,266 (GRCm39) missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34,283,181 (GRCm39) unclassified probably benign
BB010:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
BB020:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
PIT4531001:Col11a2 UTSW 17 34,265,412 (GRCm39) critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34,280,586 (GRCm39) missense probably benign 0.00
R0005:Col11a2 UTSW 17 34,281,853 (GRCm39) unclassified probably benign
R0099:Col11a2 UTSW 17 34,268,648 (GRCm39) missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34,276,249 (GRCm39) missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34,281,520 (GRCm39) unclassified probably benign
R0352:Col11a2 UTSW 17 34,261,501 (GRCm39) missense probably benign 0.43
R0362:Col11a2 UTSW 17 34,281,420 (GRCm39) splice site probably null
R0491:Col11a2 UTSW 17 34,261,186 (GRCm39) missense probably null 0.00
R0531:Col11a2 UTSW 17 34,277,351 (GRCm39) splice site probably benign
R0538:Col11a2 UTSW 17 34,270,302 (GRCm39) splice site probably benign
R0646:Col11a2 UTSW 17 34,278,322 (GRCm39) critical splice donor site probably null
R0676:Col11a2 UTSW 17 34,276,249 (GRCm39) missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34,278,124 (GRCm39) missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34,274,228 (GRCm39) missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34,282,869 (GRCm39) unclassified probably benign
R1872:Col11a2 UTSW 17 34,281,529 (GRCm39) unclassified probably benign
R1941:Col11a2 UTSW 17 34,263,925 (GRCm39) missense probably benign 0.01
R1945:Col11a2 UTSW 17 34,278,142 (GRCm39) missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34,271,143 (GRCm39) missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34,283,771 (GRCm39) unclassified probably benign
R2258:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2259:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2260:Col11a2 UTSW 17 34,258,651 (GRCm39) missense probably benign
R2761:Col11a2 UTSW 17 34,270,000 (GRCm39) missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34,265,442 (GRCm39) missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34,273,154 (GRCm39) missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34,258,599 (GRCm39) unclassified probably benign
R4039:Col11a2 UTSW 17 34,264,748 (GRCm39) missense probably benign 0.00
R4675:Col11a2 UTSW 17 34,283,267 (GRCm39) critical splice donor site probably null
R4810:Col11a2 UTSW 17 34,276,086 (GRCm39) missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34,269,937 (GRCm39) missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34,261,164 (GRCm39) missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34,283,062 (GRCm39) unclassified probably benign
R5355:Col11a2 UTSW 17 34,270,775 (GRCm39) missense probably benign 0.07
R5384:Col11a2 UTSW 17 34,278,148 (GRCm39) critical splice donor site probably null
R5534:Col11a2 UTSW 17 34,269,998 (GRCm39) missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34,283,159 (GRCm39) unclassified probably benign
R6252:Col11a2 UTSW 17 34,261,186 (GRCm39) missense probably null 0.00
R6327:Col11a2 UTSW 17 34,262,291 (GRCm39) missense probably benign 0.32
R6828:Col11a2 UTSW 17 34,272,607 (GRCm39) splice site probably null
R6860:Col11a2 UTSW 17 34,272,572 (GRCm39) missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34,283,993 (GRCm39) missense unknown
R6992:Col11a2 UTSW 17 34,266,118 (GRCm39) missense probably benign 0.01
R7292:Col11a2 UTSW 17 34,270,482 (GRCm39) missense unknown
R7543:Col11a2 UTSW 17 34,269,430 (GRCm39) missense unknown
R7933:Col11a2 UTSW 17 34,275,029 (GRCm39) nonsense probably null
R8157:Col11a2 UTSW 17 34,280,230 (GRCm39) missense unknown
R8161:Col11a2 UTSW 17 34,270,264 (GRCm39) missense unknown
R8209:Col11a2 UTSW 17 34,266,253 (GRCm39) critical splice donor site probably null
R8493:Col11a2 UTSW 17 34,278,936 (GRCm39) missense possibly damaging 0.82
R8705:Col11a2 UTSW 17 34,268,769 (GRCm39) missense unknown
R8901:Col11a2 UTSW 17 34,262,254 (GRCm39) missense probably damaging 1.00
R8946:Col11a2 UTSW 17 34,270,757 (GRCm39) missense probably benign 0.40
R9010:Col11a2 UTSW 17 34,283,760 (GRCm39) missense unknown
R9108:Col11a2 UTSW 17 34,276,634 (GRCm39) missense probably benign 0.21
R9138:Col11a2 UTSW 17 34,279,847 (GRCm39) missense
R9147:Col11a2 UTSW 17 34,273,119 (GRCm39) splice site probably benign
R9148:Col11a2 UTSW 17 34,273,119 (GRCm39) splice site probably benign
R9338:Col11a2 UTSW 17 34,266,204 (GRCm39) missense unknown
R9485:Col11a2 UTSW 17 34,258,669 (GRCm39) missense unknown
X0017:Col11a2 UTSW 17 34,278,959 (GRCm39) critical splice donor site probably null
X0064:Col11a2 UTSW 17 34,261,221 (GRCm39) missense possibly damaging 0.88
Z1176:Col11a2 UTSW 17 34,275,376 (GRCm39) missense unknown
Z1177:Col11a2 UTSW 17 34,270,640 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATGTTACATCTACACATCGCCGTCC -3'
(R):5'- GACAGCCATCTCTGAACTCCTTGAC -3'

Sequencing Primer
(F):5'- TCAGTATTAGAGATGCAGGCACC -3'
(R):5'- ACTCCTTGACATAAGGGCTG -3'
Posted On 2013-05-09