Incidental Mutation 'R4607:Cpeb3'
ID346110
Institutional Source Beutler Lab
Gene Symbol Cpeb3
Ensembl Gene ENSMUSG00000039652
Gene Namecytoplasmic polyadenylation element binding protein 3
Synonyms4831444O18Rik
MMRRC Submission 041818-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4607 (G1)
Quality Score216
Status Validated
Chromosome19
Chromosomal Location37021291-37208601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37174839 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000120416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079754] [ENSMUST00000123727] [ENSMUST00000124158] [ENSMUST00000126188] [ENSMUST00000126781] [ENSMUST00000128642] [ENSMUST00000131917] [ENSMUST00000132580] [ENSMUST00000133988] [ENSMUST00000136286] [ENSMUST00000142973] [ENSMUST00000154376]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079754
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078690
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000123727
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121987
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 429 501 2.01e-5 SMART
RRM 537 610 1e-2 SMART
PDB:2M13|A 611 676 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124158
SMART Domains Protein: ENSMUSP00000115656
Gene: ENSMUSG00000039652

DomainStartEndE-ValueType
RRM 159 231 2.01e-5 SMART
RRM 267 340 1e-2 SMART
PDB:2M13|A 341 406 6e-7 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000126188
AA Change: S46P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120416
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 2.01e-5 SMART
RRM 545 618 1e-2 SMART
PDB:2M13|A 619 684 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000126781
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122442
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RRM 437 509 8.3e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128642
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115038
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131917
AA Change: S46P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123080
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132580
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118723
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133988
AA Change: S46P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116749
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136286
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116309
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
RRM 443 515 2.01e-5 SMART
RRM 551 624 1e-2 SMART
PDB:2M13|A 625 690 1e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000142973
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117242
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154376
AA Change: S46P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116172
Gene: ENSMUSG00000039652
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 54 69 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 168 210 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
low complexity region 410 420 N/A INTRINSIC
RRM 460 532 2.01e-5 SMART
RRM 568 641 1e-2 SMART
PDB:2M13|A 642 707 1e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180609
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased anxiety-related response, enhanced contextual conditioning behavior, abnormal spatial reference memory, hypoactivity and abnormal hippocampus pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 G T 5: 94,383,528 R90S probably benign Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adgra3 A C 5: 49,970,739 V800G probably damaging Het
Aldh1a1 A T 19: 20,621,687 Y154F probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Chrna9 A G 5: 65,976,735 I310V possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlgap5 A G 14: 47,413,018 I151T possibly damaging Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
Erlin1 C T 19: 44,063,035 V76M probably damaging Het
Fam161a G A 11: 23,020,710 S296N probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm906 G A 13: 50,245,506 T928I possibly damaging Het
Gna14 A G 19: 16,533,711 probably null Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ipo11 A G 13: 106,900,811 S175P probably damaging Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Map3k2 T C 18: 32,199,977 L68P probably damaging Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Mink1 A G 11: 70,606,067 E417G possibly damaging Het
Myrf G T 19: 10,229,067 D29E probably damaging Het
Nelfcd T A 2: 174,423,162 D215E probably benign Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Olfr951 T C 9: 39,394,735 *312Q probably null Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdh9 T A 14: 93,015,573 N1218I probably benign Het
Pcdhga6 A G 18: 37,708,618 N464D probably damaging Het
Rdx T A 9: 52,068,837 S243R probably damaging Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slit1 C A 19: 41,616,793 R873L probably benign Het
Strc T A 2: 121,372,945 I1130F probably benign Het
Tlk2 T A 11: 105,255,018 L350Q probably damaging Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Trav15-1-dv6-1 T A 14: 53,560,054 H53Q probably benign Het
Trbv24 T C 6: 41,218,401 probably benign Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp512b C A 2: 181,588,774 R441L probably damaging Het
Other mutations in Cpeb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Cpeb3 APN 19 37054295 missense probably damaging 1.00
IGL01402:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01404:Cpeb3 APN 19 37088548 missense probably benign 0.01
IGL01702:Cpeb3 APN 19 37126382 missense possibly damaging 0.85
IGL01811:Cpeb3 APN 19 37044608 missense probably damaging 1.00
IGL03036:Cpeb3 APN 19 37024948 missense probably damaging 1.00
R0580:Cpeb3 UTSW 19 37174035 missense probably benign 0.02
R1463:Cpeb3 UTSW 19 37139100 missense probably benign 0.08
R1572:Cpeb3 UTSW 19 37139082 missense probably benign 0.38
R1914:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R1915:Cpeb3 UTSW 19 37054265 missense probably damaging 1.00
R2031:Cpeb3 UTSW 19 37044679 missense probably damaging 1.00
R4296:Cpeb3 UTSW 19 37173989 missense possibly damaging 0.90
R4528:Cpeb3 UTSW 19 37139088 missense possibly damaging 0.85
R4909:Cpeb3 UTSW 19 37174659 missense probably damaging 1.00
R4909:Cpeb3 UTSW 19 37174233 missense possibly damaging 0.63
R5240:Cpeb3 UTSW 19 37174515 missense probably damaging 0.99
R5985:Cpeb3 UTSW 19 37087552 missense probably damaging 1.00
R6179:Cpeb3 UTSW 19 37088453 missense probably damaging 1.00
R6309:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R6768:Cpeb3 UTSW 19 37025032 missense possibly damaging 0.92
R6787:Cpeb3 UTSW 19 37044689 missense possibly damaging 0.87
R7102:Cpeb3 UTSW 19 37174719 missense probably benign
R7194:Cpeb3 UTSW 19 37174752 missense probably benign
R7422:Cpeb3 UTSW 19 37174500 missense probably benign 0.13
R7594:Cpeb3 UTSW 19 37174151 missense possibly damaging 0.70
R7630:Cpeb3 UTSW 19 37054293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTGCCTGTGGACCAG -3'
(R):5'- GGGCATTCATGATCACACTGAC -3'

Sequencing Primer
(F):5'- TGTGGACCAGGTGCTGC -3'
(R):5'- TTCATGATCACACTGACAATAACG -3'
Posted On2015-09-25