Incidental Mutation 'R4621:Magel2'
ID346145
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62377738 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 130 (H130L)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect unknown
Transcript: ENSMUST00000080403
AA Change: H130L
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: H130L

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
R7836:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
R7919:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Z1177:Magel2 UTSW 7 62379607 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCTAAGTACGAATCTGGGG -3'
(R):5'- ATGGGTCATAGGGTTCCCAG -3'

Sequencing Primer
(F):5'- AGTGCCTGCAGTCCATAGC -3'
(R):5'- TCCCAGGAGGAGGATGGTGAC -3'
Posted On2015-09-25