Incidental Mutation 'R4621:Abhd2'
ID346146
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79325487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 142 (Y142H)
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably damaging
Transcript: ENSMUST00000037315
AA Change: Y142H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202
AA Change: Y142H

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135333
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1587:Abhd2 UTSW 7 79354010 missense probably benign 0.01
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4374:Abhd2 UTSW 7 79323530 missense probably benign 0.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R5599:Abhd2 UTSW 7 79296998 splice site probably null
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R7617:Abhd2 UTSW 7 79348284 missense probably benign 0.10
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGGGTACATCTTCCTTTTAGCAAAC -3'
(R):5'- ATAGTCTCAAGGCAACAGGC -3'

Sequencing Primer
(F):5'- CTTTCATTCCAGCACTAGGGAGG -3'
(R):5'- TGGAGGGGCTGCACACTC -3'
Posted On2015-09-25