Incidental Mutation 'R4621:Frem3'
ID346154
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80669191 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695] [ENSMUST00000039695]
Predicted Effect probably null
Transcript: ENSMUST00000039695
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039695
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCACACACGATTTAATAAGGG -3'
(R):5'- CCCCATTCTAATAGGCCCATTG -3'

Sequencing Primer
(F):5'- GGGATCCCCTAAACTCAAATCTCCTG -3'
(R):5'- GCCAGGTGCACTCTCCCTAAC -3'
Posted On2015-09-25