Incidental Mutation 'R4621:Adap2'
ID346170
Institutional Source Beutler Lab
Gene Symbol Adap2
Ensembl Gene ENSMUSG00000020709
Gene NameArfGAP with dual PH domains 2
Synonymscentaurin alpha 2, Centa2
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80154105-80178958 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 80174073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021050]
Predicted Effect probably null
Transcript: ENSMUST00000021050
SMART Domains Protein: ENSMUSP00000021050
Gene: ENSMUSG00000020709

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
PH 133 235 4.57e-8 SMART
PH 256 363 2.35e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140556
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds beta-tubulin and increases the stability of microtubules. The encoded protein can also translocate to the cell membrane and bind phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4). In addition, this protein is a GTPase-activating protein for ADP ribosylation factor 6 and may be able to block the entry of some RNA viruses. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Adap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Adap2 APN 11 80160189 missense probably damaging 1.00
IGL02442:Adap2 APN 11 80177206 missense probably damaging 1.00
IGL02953:Adap2 APN 11 80154300 missense probably damaging 0.99
PIT4283001:Adap2 UTSW 11 80177263 missense probably damaging 1.00
R0157:Adap2 UTSW 11 80165701 missense probably damaging 1.00
R0382:Adap2 UTSW 11 80178385 splice site probably benign
R0499:Adap2 UTSW 11 80176079 missense probably damaging 1.00
R0722:Adap2 UTSW 11 80156984 missense possibly damaging 0.86
R0828:Adap2 UTSW 11 80165664 splice site probably benign
R1938:Adap2 UTSW 11 80170682 missense probably damaging 1.00
R2268:Adap2 UTSW 11 80165726 missense probably damaging 0.99
R3103:Adap2 UTSW 11 80157033 missense probably damaging 1.00
R5157:Adap2 UTSW 11 80156946 missense probably damaging 1.00
R6326:Adap2 UTSW 11 80155022 missense probably damaging 1.00
R6914:Adap2 UTSW 11 80155065 missense probably benign 0.01
R6942:Adap2 UTSW 11 80155065 missense probably benign 0.01
R7835:Adap2 UTSW 11 80160231 missense probably benign 0.11
R8879:Adap2 UTSW 11 80156959 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAAACCATACTGGGGCTCATG -3'
(R):5'- GTGTCAGCACAGAAGCTCAC -3'

Sequencing Primer
(F):5'- CATACTGGGGCTCATGGACTG -3'
(R):5'- GAAGCTCACAAACACTGGTG -3'
Posted On2015-09-25