Incidental Mutation 'R0255:Dock10'
ID34620
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 038486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0255 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80605876 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 203 (Y203C)
Ref Sequence ENSEMBL: ENSMUSP00000140513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000186087] [ENSMUST00000187774] [ENSMUST00000190983] [ENSMUST00000191449]
Predicted Effect probably damaging
Transcript: ENSMUST00000077946
AA Change: Y221C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: Y221C

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186087
AA Change: Y234C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140102
Gene: ENSMUSG00000038608
AA Change: Y234C

DomainStartEndE-ValueType
Pfam:DUF3398 71 166 1.5e-29 PFAM
PH 195 305 3.9e-19 SMART
Blast:PH 363 475 3e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000187774
AA Change: Y209C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: Y209C

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190983
AA Change: Y208C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: Y208C

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191449
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140513
Gene: ENSMUSG00000038608
AA Change: Y203C

DomainStartEndE-ValueType
Pfam:DUF3398 40 135 1.1e-32 PFAM
PH 164 274 8.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191505
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,045 F119S probably damaging Het
1810011H11Rik A G 14: 32,808,363 K83E possibly damaging Het
Abca13 C A 11: 9,581,545 Q4591K probably damaging Het
Anapc1 A T 2: 128,634,711 M1329K probably damaging Het
Aoah A T 13: 20,979,540 K338* probably null Het
Ascc3 A T 10: 50,645,058 T416S probably benign Het
Baz2a A G 10: 128,114,639 T484A possibly damaging Het
Btnl6 T C 17: 34,508,503 N351S probably benign Het
Cacna1s T G 1: 136,118,806 I1772S possibly damaging Het
Ccdc8 A G 7: 16,995,657 D357G unknown Het
Ccna1 T C 3: 55,050,628 E152G probably damaging Het
Cct4 A G 11: 22,999,073 D273G probably damaging Het
Cd9 A G 6: 125,463,740 V96A probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh7 T C 1: 109,994,306 S43P probably benign Het
Cep95 G A 11: 106,811,271 V365M probably benign Het
Ces1c T C 8: 93,127,524 T128A probably benign Het
Chil5 A G 3: 106,019,267 V82A probably damaging Het
Clmn T C 12: 104,781,764 D508G probably benign Het
Cog8 A T 8: 107,049,145 probably benign Het
Cst3 A T 2: 148,875,169 V70E probably damaging Het
Ctcf A G 8: 105,664,039 T93A possibly damaging Het
Ctsk C A 3: 95,508,877 N315K probably benign Het
Cyp2j12 G T 4: 96,141,025 D6E probably benign Het
Dhx34 A G 7: 16,205,992 V655A probably benign Het
Dok7 A T 5: 35,064,334 D26V probably damaging Het
Epha8 G A 4: 136,940,286 H295Y probably damaging Het
Esf1 A G 2: 140,148,923 probably benign Het
Fam83c A G 2: 155,829,752 S588P probably benign Het
Fat3 G A 9: 15,969,706 probably benign Het
Fhdc1 T C 3: 84,453,510 probably benign Het
Frmd4b A G 6: 97,308,086 V338A probably damaging Het
Fsd1l A G 4: 53,694,727 T394A probably damaging Het
Gbf1 A G 19: 46,254,110 probably benign Het
Glg1 G T 8: 111,159,858 Q1101K possibly damaging Het
Glt8d2 T A 10: 82,651,527 probably null Het
Gm19345 T C 7: 19,854,930 probably benign Het
Gpr179 A T 11: 97,336,066 D1754E probably benign Het
Hydin A G 8: 110,565,018 T3381A probably benign Het
Igkv12-41 G A 6: 69,858,838 T16I possibly damaging Het
Insl5 A G 4: 103,018,116 *146Q probably null Het
Iqce A T 5: 140,666,202 I655N possibly damaging Het
Irf2bp1 G A 7: 19,005,002 R189H possibly damaging Het
Itsn1 C T 16: 91,806,090 probably benign Het
Kansl3 A T 1: 36,344,969 I724N probably benign Het
Kcna4 T C 2: 107,296,562 I547T probably damaging Het
Klk1b4 A T 7: 44,210,734 I91F probably benign Het
Lmbr1 A G 5: 29,252,755 S282P probably damaging Het
Lrrc17 G A 5: 21,560,969 A150T probably benign Het
Lrrc2 A G 9: 110,980,898 E334G possibly damaging Het
Lrrc7 G A 3: 158,160,838 Q1077* probably null Het
Mapk8 A T 14: 33,387,307 probably benign Het
Mast1 T A 8: 84,912,021 T1560S probably benign Het
Mdh1b C A 1: 63,719,618 A272S probably damaging Het
Myo15b T C 11: 115,886,283 Y912H probably damaging Het
Nf1 T G 11: 79,408,699 probably null Het
Nme7 T A 1: 164,345,375 D218E probably damaging Het
Nsun7 T A 5: 66,289,408 probably benign Het
Nxpe2 A G 9: 48,340,570 probably null Het
Olfr135 T G 17: 38,208,395 I50R probably benign Het
Olfr394 A G 11: 73,887,829 V181A probably benign Het
Olfr473 T A 7: 107,934,168 V216D probably damaging Het
Olfr698 G A 7: 106,752,989 T133I probably benign Het
P2ry1 T C 3: 61,003,530 V30A probably benign Het
Pgm1 T A 5: 64,112,043 I491N possibly damaging Het
Pkd1l3 A T 8: 109,638,754 D1169V probably damaging Het
Poldip2 T A 11: 78,512,363 S18T probably benign Het
Ppp1r32 C T 19: 10,475,054 R364Q probably damaging Het
Pqlc1 C T 18: 80,263,518 A101V probably benign Het
Prg4 C T 1: 150,455,807 probably benign Het
Prkab2 T A 3: 97,667,412 Y241* probably null Het
Prmt7 A G 8: 106,227,207 probably benign Het
Proser3 T A 7: 30,546,417 R80W probably damaging Het
Prr12 A G 7: 45,049,991 probably benign Het
Psmd1 A T 1: 86,078,582 L223F probably damaging Het
Rab13 A G 3: 90,223,781 probably benign Het
Rgl1 C T 1: 152,552,596 C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 noncoding transcript Het
Rusc2 T C 4: 43,423,954 V1036A probably damaging Het
Sae1 T A 7: 16,370,322 K121* probably null Het
Sap130 C T 18: 31,680,506 P539S probably damaging Het
Scube2 A G 7: 109,824,872 L475P probably damaging Het
Sec16a T C 2: 26,431,186 D1298G probably damaging Het
Serpinb9b T C 13: 33,038,020 F206L probably benign Het
Sh3bp1 T A 15: 78,904,334 Y202* probably null Het
Shprh T A 10: 11,186,391 C1177S possibly damaging Het
Slc27a6 T C 18: 58,609,865 Y542H possibly damaging Het
Slc41a1 T C 1: 131,843,912 probably benign Het
Slc46a1 T C 11: 78,470,799 F424L probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc6a20a A G 9: 123,664,621 V65A probably damaging Het
Slc9c1 T A 16: 45,554,300 S343T probably benign Het
Spcs3 C A 8: 54,528,380 R60I probably benign Het
Ssfa2 T A 2: 79,660,466 L976Q probably damaging Het
Tbc1d16 C A 11: 119,147,575 R764L possibly damaging Het
Tcaf2 A T 6: 42,642,904 V63E possibly damaging Het
Tmc1 G T 19: 20,789,587 A750E possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tmx3 T C 18: 90,540,006 I394T probably damaging Het
Trank1 G A 9: 111,366,024 E1039K possibly damaging Het
Trpc4ap A G 2: 155,657,946 probably benign Het
Tsen54 T C 11: 115,815,408 C123R probably damaging Het
Ubtd1 A G 19: 42,031,934 D39G possibly damaging Het
Vmn1r181 A T 7: 23,984,334 M75L probably benign Het
Zc3h7a T C 16: 11,140,737 T847A probably damaging Het
Zc3hav1 A G 6: 38,336,550 C187R probably damaging Het
Zfp692 G A 11: 58,310,403 probably benign Het
Zmiz1 G A 14: 25,654,495 probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
R7359:Dock10 UTSW 1 80709348 missense probably benign 0.01
R7423:Dock10 UTSW 1 80523780 missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80540315 missense probably damaging 0.99
R7483:Dock10 UTSW 1 80515566 missense probably benign 0.01
R7487:Dock10 UTSW 1 80585048 missense probably benign 0.00
R7789:Dock10 UTSW 1 80559213 missense possibly damaging 0.82
RF021:Dock10 UTSW 1 80564573 critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAGGCTAGAACAGCTCTTG -3'
(R):5'- GCTTGGCTGCCTTGCTAATGATGAC -3'

Sequencing Primer
(F):5'- GGCTAGAACAGCTCTTGACTTAC -3'
(R):5'- TTCTCAAGGCACAGCATGG -3'
Posted On2013-05-09