Incidental Mutation 'R4622:Plxna2'
ID346205
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 041887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4622 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 194812150 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1892 (I1892L)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: I1892L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: I1892L

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124785
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G T 1: 43,742,321 R121L possibly damaging Het
2900011O08Rik A C 16: 14,093,922 E44A possibly damaging Het
Aadacl2 A T 3: 60,007,053 N26Y probably damaging Het
Aass C T 6: 23,092,330 D194N probably damaging Het
Acp7 T C 7: 28,614,397 Y404C probably damaging Het
Acsl1 A T 8: 46,526,373 I421L probably benign Het
Adgrb3 A T 1: 25,826,488 D91E probably damaging Het
Adgrg3 T C 8: 95,040,525 S503P probably damaging Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Arhgap32 A T 9: 32,239,348 I15F possibly damaging Het
Arid1b G T 17: 4,995,050 probably benign Het
Asnsd1 A G 1: 53,348,219 V83A probably benign Het
Atg101 A G 15: 101,293,332 probably benign Het
Atp8a1 T C 5: 67,682,713 probably benign Het
Aurkb T A 11: 69,048,362 L137Q probably damaging Het
AY702103 A T 17: 50,240,001 noncoding transcript Het
B3gnt9 A G 8: 105,253,845 S304P probably benign Het
Babam2 T C 5: 32,007,312 V310A probably damaging Het
Batf A G 12: 85,708,553 D60G possibly damaging Het
Baz1a A T 12: 54,941,515 I283K probably benign Het
BC067074 A G 13: 113,320,081 D887G probably benign Het
Bst1 T G 5: 43,818,919 probably benign Het
C2 C A 17: 34,863,674 V490L probably damaging Het
Cacna1e T C 1: 154,471,565 E952G possibly damaging Het
Ccnyl1 A G 1: 64,718,258 D262G probably damaging Het
Cdc42bpa A T 1: 180,074,658 K493N probably damaging Het
Cenpe A G 3: 135,243,708 T85A probably benign Het
Ces2e T A 8: 104,928,709 probably null Het
Chd3 T A 11: 69,349,008 R1665W probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Ctnnd2 A T 15: 30,887,169 M781L probably benign Het
Ctnnd2 A G 15: 31,009,113 T1094A probably benign Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Ddx54 G A 5: 120,626,423 V732M probably damaging Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Eva1c T A 16: 90,897,455 probably null Het
Evi5l T C 8: 4,202,909 probably benign Het
Fasl A G 1: 161,787,134 L120P probably benign Het
Gm10334 A T 6: 41,445,312 I53N probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
H2-M9 A T 17: 36,641,824 probably null Het
Hdgf C A 3: 87,914,577 N198K possibly damaging Het
Hspa9 A T 18: 34,949,037 M172K possibly damaging Het
Il1r1 A C 1: 40,312,420 L406F probably damaging Het
Il31 T C 5: 123,480,435 D96G probably damaging Het
Inhbc A G 10: 127,357,277 I290T probably benign Het
Lrp2 A T 2: 69,460,349 V3589D possibly damaging Het
Lrrc14 A T 15: 76,716,340 probably benign Het
Lyst G A 13: 13,674,398 A2057T probably benign Het
Macf1 A G 4: 123,372,348 probably null Het
Mapk10 C A 5: 102,989,724 G209V probably damaging Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Met G T 6: 17,513,384 R411L probably benign Het
Mkl2 G A 16: 13,332,706 G102D probably damaging Het
Mrpl4 G A 9: 21,007,497 R176Q probably damaging Het
Mtmr3 T C 11: 4,491,067 T528A possibly damaging Het
Mtmr7 A T 8: 40,581,541 N246K probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Necab3 A G 2: 154,555,582 probably null Het
Nr1d1 C T 11: 98,769,884 C419Y probably damaging Het
Nwd1 C A 8: 72,667,300 A397E probably damaging Het
Oas1f A T 5: 120,848,327 K114N probably damaging Het
Olfr1136 T A 2: 87,693,643 K80* probably null Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr395 C A 11: 73,906,911 V194F possibly damaging Het
Olfr46 T A 7: 140,610,698 C169* probably null Het
Olfr613 G T 7: 103,552,154 R123L probably benign Het
Osbpl8 T C 10: 111,291,496 S814P probably benign Het
Pcdhgb7 A T 18: 37,753,130 Q451L probably benign Het
Pde7b C T 10: 20,418,792 R300Q probably damaging Het
Pgghg A G 7: 140,941,496 probably null Het
Plcg1 A G 2: 160,747,768 probably benign Het
Ppt2 A G 17: 34,625,901 V123A probably benign Het
Prdx5 G T 19: 6,906,973 probably benign Het
Prpf40b A G 15: 99,316,316 D819G probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Rab3gap1 T C 1: 127,942,419 C919R probably benign Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rec8 C T 14: 55,624,758 R480C probably damaging Het
Reg3d A G 6: 78,377,459 L53S probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Scn2a T C 2: 65,752,027 V1573A probably benign Het
Selenoo G T 15: 89,095,707 G353* probably null Het
Siva1 A G 12: 112,645,067 Y34C probably damaging Het
Slc2a4 C T 11: 69,944,774 probably benign Het
Slc39a12 A T 2: 14,400,325 T243S probably benign Het
Slc9b2 T C 3: 135,332,518 I453T probably damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Tbc1d24 A T 17: 24,208,891 D32E probably benign Het
Tet1 T A 10: 62,819,474 H1556L possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Ttn A T 2: 76,900,952 probably benign Het
Uimc1 A T 13: 55,077,494 L89H probably damaging Het
Vipas39 A G 12: 87,244,543 I343T probably damaging Het
Vmn2r71 G T 7: 85,620,609 V443L probably benign Het
Zbtb14 G A 17: 69,388,347 D347N possibly damaging Het
Zfp980 G T 4: 145,702,057 C452F probably damaging Het
Zmym5 T A 14: 56,812,236 probably benign Het
Znfx1 T C 2: 167,041,753 T145A possibly damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTGAATCATGCCAGTTATTTGAC -3'
(R):5'- AACATGGCTGCCATTGACAG -3'

Sequencing Primer
(F):5'- GACATTACATTCCTAAAGGCAGATTG -3'
(R):5'- CCATTGACAGAGGAGCCTTTC -3'
Posted On2015-09-25