Incidental Mutation 'R4622:Atp8a1'
ID346225
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission 041887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4622 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 67682713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155911
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G T 1: 43,742,321 R121L possibly damaging Het
2900011O08Rik A C 16: 14,093,922 E44A possibly damaging Het
Aadacl2 A T 3: 60,007,053 N26Y probably damaging Het
Aass C T 6: 23,092,330 D194N probably damaging Het
Acp7 T C 7: 28,614,397 Y404C probably damaging Het
Acsl1 A T 8: 46,526,373 I421L probably benign Het
Adgrb3 A T 1: 25,826,488 D91E probably damaging Het
Adgrg3 T C 8: 95,040,525 S503P probably damaging Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Arhgap32 A T 9: 32,239,348 I15F possibly damaging Het
Arid1b G T 17: 4,995,050 probably benign Het
Asnsd1 A G 1: 53,348,219 V83A probably benign Het
Atg101 A G 15: 101,293,332 probably benign Het
Aurkb T A 11: 69,048,362 L137Q probably damaging Het
AY702103 A T 17: 50,240,001 noncoding transcript Het
B3gnt9 A G 8: 105,253,845 S304P probably benign Het
Babam2 T C 5: 32,007,312 V310A probably damaging Het
Batf A G 12: 85,708,553 D60G possibly damaging Het
Baz1a A T 12: 54,941,515 I283K probably benign Het
BC067074 A G 13: 113,320,081 D887G probably benign Het
Bst1 T G 5: 43,818,919 probably benign Het
C2 C A 17: 34,863,674 V490L probably damaging Het
Cacna1e T C 1: 154,471,565 E952G possibly damaging Het
Ccnyl1 A G 1: 64,718,258 D262G probably damaging Het
Cdc42bpa A T 1: 180,074,658 K493N probably damaging Het
Cenpe A G 3: 135,243,708 T85A probably benign Het
Ces2e T A 8: 104,928,709 probably null Het
Chd3 T A 11: 69,349,008 R1665W probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Ctnnd2 A T 15: 30,887,169 M781L probably benign Het
Ctnnd2 A G 15: 31,009,113 T1094A probably benign Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Ddx54 G A 5: 120,626,423 V732M probably damaging Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Eva1c T A 16: 90,897,455 probably null Het
Evi5l T C 8: 4,202,909 probably benign Het
Fasl A G 1: 161,787,134 L120P probably benign Het
Gm10334 A T 6: 41,445,312 I53N probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
H2-M9 A T 17: 36,641,824 probably null Het
Hdgf C A 3: 87,914,577 N198K possibly damaging Het
Hspa9 A T 18: 34,949,037 M172K possibly damaging Het
Il1r1 A C 1: 40,312,420 L406F probably damaging Het
Il31 T C 5: 123,480,435 D96G probably damaging Het
Inhbc A G 10: 127,357,277 I290T probably benign Het
Lrp2 A T 2: 69,460,349 V3589D possibly damaging Het
Lrrc14 A T 15: 76,716,340 probably benign Het
Lyst G A 13: 13,674,398 A2057T probably benign Het
Macf1 A G 4: 123,372,348 probably null Het
Mapk10 C A 5: 102,989,724 G209V probably damaging Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Met G T 6: 17,513,384 R411L probably benign Het
Mkl2 G A 16: 13,332,706 G102D probably damaging Het
Mrpl4 G A 9: 21,007,497 R176Q probably damaging Het
Mtmr3 T C 11: 4,491,067 T528A possibly damaging Het
Mtmr7 A T 8: 40,581,541 N246K probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Necab3 A G 2: 154,555,582 probably null Het
Nr1d1 C T 11: 98,769,884 C419Y probably damaging Het
Nwd1 C A 8: 72,667,300 A397E probably damaging Het
Oas1f A T 5: 120,848,327 K114N probably damaging Het
Olfr1136 T A 2: 87,693,643 K80* probably null Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr395 C A 11: 73,906,911 V194F possibly damaging Het
Olfr46 T A 7: 140,610,698 C169* probably null Het
Olfr613 G T 7: 103,552,154 R123L probably benign Het
Osbpl8 T C 10: 111,291,496 S814P probably benign Het
Pcdhgb7 A T 18: 37,753,130 Q451L probably benign Het
Pde7b C T 10: 20,418,792 R300Q probably damaging Het
Pgghg A G 7: 140,941,496 probably null Het
Plcg1 A G 2: 160,747,768 probably benign Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppt2 A G 17: 34,625,901 V123A probably benign Het
Prdx5 G T 19: 6,906,973 probably benign Het
Prpf40b A G 15: 99,316,316 D819G probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Rab3gap1 T C 1: 127,942,419 C919R probably benign Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rec8 C T 14: 55,624,758 R480C probably damaging Het
Reg3d A G 6: 78,377,459 L53S probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Scn2a T C 2: 65,752,027 V1573A probably benign Het
Selenoo G T 15: 89,095,707 G353* probably null Het
Siva1 A G 12: 112,645,067 Y34C probably damaging Het
Slc2a4 C T 11: 69,944,774 probably benign Het
Slc39a12 A T 2: 14,400,325 T243S probably benign Het
Slc9b2 T C 3: 135,332,518 I453T probably damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Tbc1d24 A T 17: 24,208,891 D32E probably benign Het
Tet1 T A 10: 62,819,474 H1556L possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Ttn A T 2: 76,900,952 probably benign Het
Uimc1 A T 13: 55,077,494 L89H probably damaging Het
Vipas39 A G 12: 87,244,543 I343T probably damaging Het
Vmn2r71 G T 7: 85,620,609 V443L probably benign Het
Zbtb14 G A 17: 69,388,347 D347N possibly damaging Het
Zfp980 G T 4: 145,702,057 C452F probably damaging Het
Zmym5 T A 14: 56,812,236 probably benign Het
Znfx1 T C 2: 167,041,753 T145A possibly damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCCAACATTTGTAGTTCGCTG -3'
(R):5'- GCTCTTCGGAAGGAAAATGATTTTG -3'

Sequencing Primer
(F):5'- CTGGAGAGAGAGCTCAGTAGTC -3'
(R):5'- GCTCTTATAATTGATGGGAAGACC -3'
Posted On2015-09-25