Incidental Mutation 'R0255:Cacna1s'
ID34625
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 038486-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0255 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 136118806 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1772 (I1772S)
Ref Sequence ENSEMBL: ENSMUSP00000107699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112064
AA Change: I1793S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: I1793S

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112068
AA Change: I1772S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: I1772S

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159106
Predicted Effect possibly damaging
Transcript: ENSMUST00000160641
AA Change: I1791S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: I1791S

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161865
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194155
Meta Mutation Damage Score 0.1345 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,045 F119S probably damaging Het
1810011H11Rik A G 14: 32,808,363 K83E possibly damaging Het
Abca13 C A 11: 9,581,545 Q4591K probably damaging Het
Anapc1 A T 2: 128,634,711 M1329K probably damaging Het
Aoah A T 13: 20,979,540 K338* probably null Het
Ascc3 A T 10: 50,645,058 T416S probably benign Het
Baz2a A G 10: 128,114,639 T484A possibly damaging Het
Btnl6 T C 17: 34,508,503 N351S probably benign Het
Ccdc8 A G 7: 16,995,657 D357G unknown Het
Ccna1 T C 3: 55,050,628 E152G probably damaging Het
Cct4 A G 11: 22,999,073 D273G probably damaging Het
Cd9 A G 6: 125,463,740 V96A probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh7 T C 1: 109,994,306 S43P probably benign Het
Cep95 G A 11: 106,811,271 V365M probably benign Het
Ces1c T C 8: 93,127,524 T128A probably benign Het
Chil5 A G 3: 106,019,267 V82A probably damaging Het
Clmn T C 12: 104,781,764 D508G probably benign Het
Cog8 A T 8: 107,049,145 probably benign Het
Cst3 A T 2: 148,875,169 V70E probably damaging Het
Ctcf A G 8: 105,664,039 T93A possibly damaging Het
Ctsk C A 3: 95,508,877 N315K probably benign Het
Cyp2j12 G T 4: 96,141,025 D6E probably benign Het
Dhx34 A G 7: 16,205,992 V655A probably benign Het
Dock10 T C 1: 80,605,876 Y203C probably damaging Het
Dok7 A T 5: 35,064,334 D26V probably damaging Het
Epha8 G A 4: 136,940,286 H295Y probably damaging Het
Esf1 A G 2: 140,148,923 probably benign Het
Fam83c A G 2: 155,829,752 S588P probably benign Het
Fat3 G A 9: 15,969,706 probably benign Het
Fhdc1 T C 3: 84,453,510 probably benign Het
Frmd4b A G 6: 97,308,086 V338A probably damaging Het
Fsd1l A G 4: 53,694,727 T394A probably damaging Het
Gbf1 A G 19: 46,254,110 probably benign Het
Glg1 G T 8: 111,159,858 Q1101K possibly damaging Het
Glt8d2 T A 10: 82,651,527 probably null Het
Gm19345 T C 7: 19,854,930 probably benign Het
Gpr179 A T 11: 97,336,066 D1754E probably benign Het
Hydin A G 8: 110,565,018 T3381A probably benign Het
Igkv12-41 G A 6: 69,858,838 T16I possibly damaging Het
Insl5 A G 4: 103,018,116 *146Q probably null Het
Iqce A T 5: 140,666,202 I655N possibly damaging Het
Irf2bp1 G A 7: 19,005,002 R189H possibly damaging Het
Itsn1 C T 16: 91,806,090 probably benign Het
Kansl3 A T 1: 36,344,969 I724N probably benign Het
Kcna4 T C 2: 107,296,562 I547T probably damaging Het
Klk1b4 A T 7: 44,210,734 I91F probably benign Het
Lmbr1 A G 5: 29,252,755 S282P probably damaging Het
Lrrc17 G A 5: 21,560,969 A150T probably benign Het
Lrrc2 A G 9: 110,980,898 E334G possibly damaging Het
Lrrc7 G A 3: 158,160,838 Q1077* probably null Het
Mapk8 A T 14: 33,387,307 probably benign Het
Mast1 T A 8: 84,912,021 T1560S probably benign Het
Mdh1b C A 1: 63,719,618 A272S probably damaging Het
Myo15b T C 11: 115,886,283 Y912H probably damaging Het
Nf1 T G 11: 79,408,699 probably null Het
Nme7 T A 1: 164,345,375 D218E probably damaging Het
Nsun7 T A 5: 66,289,408 probably benign Het
Nxpe2 A G 9: 48,340,570 probably null Het
Olfr135 T G 17: 38,208,395 I50R probably benign Het
Olfr394 A G 11: 73,887,829 V181A probably benign Het
Olfr473 T A 7: 107,934,168 V216D probably damaging Het
Olfr698 G A 7: 106,752,989 T133I probably benign Het
P2ry1 T C 3: 61,003,530 V30A probably benign Het
Pgm1 T A 5: 64,112,043 I491N possibly damaging Het
Pkd1l3 A T 8: 109,638,754 D1169V probably damaging Het
Poldip2 T A 11: 78,512,363 S18T probably benign Het
Ppp1r32 C T 19: 10,475,054 R364Q probably damaging Het
Pqlc1 C T 18: 80,263,518 A101V probably benign Het
Prg4 C T 1: 150,455,807 probably benign Het
Prkab2 T A 3: 97,667,412 Y241* probably null Het
Prmt7 A G 8: 106,227,207 probably benign Het
Proser3 T A 7: 30,546,417 R80W probably damaging Het
Prr12 A G 7: 45,049,991 probably benign Het
Psmd1 A T 1: 86,078,582 L223F probably damaging Het
Rab13 A G 3: 90,223,781 probably benign Het
Rgl1 C T 1: 152,552,596 C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 noncoding transcript Het
Rusc2 T C 4: 43,423,954 V1036A probably damaging Het
Sae1 T A 7: 16,370,322 K121* probably null Het
Sap130 C T 18: 31,680,506 P539S probably damaging Het
Scube2 A G 7: 109,824,872 L475P probably damaging Het
Sec16a T C 2: 26,431,186 D1298G probably damaging Het
Serpinb9b T C 13: 33,038,020 F206L probably benign Het
Sh3bp1 T A 15: 78,904,334 Y202* probably null Het
Shprh T A 10: 11,186,391 C1177S possibly damaging Het
Slc27a6 T C 18: 58,609,865 Y542H possibly damaging Het
Slc41a1 T C 1: 131,843,912 probably benign Het
Slc46a1 T C 11: 78,470,799 F424L probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc6a20a A G 9: 123,664,621 V65A probably damaging Het
Slc9c1 T A 16: 45,554,300 S343T probably benign Het
Spcs3 C A 8: 54,528,380 R60I probably benign Het
Ssfa2 T A 2: 79,660,466 L976Q probably damaging Het
Tbc1d16 C A 11: 119,147,575 R764L possibly damaging Het
Tcaf2 A T 6: 42,642,904 V63E possibly damaging Het
Tmc1 G T 19: 20,789,587 A750E possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tmx3 T C 18: 90,540,006 I394T probably damaging Het
Trank1 G A 9: 111,366,024 E1039K possibly damaging Het
Trpc4ap A G 2: 155,657,946 probably benign Het
Tsen54 T C 11: 115,815,408 C123R probably damaging Het
Ubtd1 A G 19: 42,031,934 D39G possibly damaging Het
Vmn1r181 A T 7: 23,984,334 M75L probably benign Het
Zc3h7a T C 16: 11,140,737 T847A probably damaging Het
Zc3hav1 A G 6: 38,336,550 C187R probably damaging Het
Zfp692 G A 11: 58,310,403 probably benign Het
Zmiz1 G A 14: 25,654,495 probably benign Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 unclassified probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136110874 missense probably damaging 1.00
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGACTCCCTTGGATGAGCTATG -3'
(R):5'- GGCCTGTTGCCATGACGAAGTTAG -3'

Sequencing Primer
(F):5'- GATGAGCTATGGGCTCCAG -3'
(R):5'- ACGAAGTTAGCATCTGCTGC -3'
Posted On2013-05-09