Incidental Mutation 'R4622:Baz1a'
ID346262
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 041887-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4622 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54941515 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 283 (I283K)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably benign
Transcript: ENSMUST00000038926
AA Change: I283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: I283K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173176
AA Change: I66K
Predicted Effect probably benign
Transcript: ENSMUST00000173433
AA Change: I283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: I283K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G T 1: 43,742,321 R121L possibly damaging Het
2900011O08Rik A C 16: 14,093,922 E44A possibly damaging Het
Aadacl2 A T 3: 60,007,053 N26Y probably damaging Het
Aass C T 6: 23,092,330 D194N probably damaging Het
Acp7 T C 7: 28,614,397 Y404C probably damaging Het
Acsl1 A T 8: 46,526,373 I421L probably benign Het
Adgrb3 A T 1: 25,826,488 D91E probably damaging Het
Adgrg3 T C 8: 95,040,525 S503P probably damaging Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Arhgap32 A T 9: 32,239,348 I15F possibly damaging Het
Arid1b G T 17: 4,995,050 probably benign Het
Asnsd1 A G 1: 53,348,219 V83A probably benign Het
Atg101 A G 15: 101,293,332 probably benign Het
Atp8a1 T C 5: 67,682,713 probably benign Het
Aurkb T A 11: 69,048,362 L137Q probably damaging Het
AY702103 A T 17: 50,240,001 noncoding transcript Het
B3gnt9 A G 8: 105,253,845 S304P probably benign Het
Babam2 T C 5: 32,007,312 V310A probably damaging Het
Batf A G 12: 85,708,553 D60G possibly damaging Het
BC067074 A G 13: 113,320,081 D887G probably benign Het
Bst1 T G 5: 43,818,919 probably benign Het
C2 C A 17: 34,863,674 V490L probably damaging Het
Cacna1e T C 1: 154,471,565 E952G possibly damaging Het
Ccnyl1 A G 1: 64,718,258 D262G probably damaging Het
Cdc42bpa A T 1: 180,074,658 K493N probably damaging Het
Cenpe A G 3: 135,243,708 T85A probably benign Het
Ces2e T A 8: 104,928,709 probably null Het
Chd3 T A 11: 69,349,008 R1665W probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Ctnnd2 A T 15: 30,887,169 M781L probably benign Het
Ctnnd2 A G 15: 31,009,113 T1094A probably benign Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Ddx54 G A 5: 120,626,423 V732M probably damaging Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Eva1c T A 16: 90,897,455 probably null Het
Evi5l T C 8: 4,202,909 probably benign Het
Fasl A G 1: 161,787,134 L120P probably benign Het
Gm10334 A T 6: 41,445,312 I53N probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
H2-M9 A T 17: 36,641,824 probably null Het
Hdgf C A 3: 87,914,577 N198K possibly damaging Het
Hspa9 A T 18: 34,949,037 M172K possibly damaging Het
Il1r1 A C 1: 40,312,420 L406F probably damaging Het
Il31 T C 5: 123,480,435 D96G probably damaging Het
Inhbc A G 10: 127,357,277 I290T probably benign Het
Lrp2 A T 2: 69,460,349 V3589D possibly damaging Het
Lrrc14 A T 15: 76,716,340 probably benign Het
Lyst G A 13: 13,674,398 A2057T probably benign Het
Macf1 A G 4: 123,372,348 probably null Het
Mapk10 C A 5: 102,989,724 G209V probably damaging Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Met G T 6: 17,513,384 R411L probably benign Het
Mkl2 G A 16: 13,332,706 G102D probably damaging Het
Mrpl4 G A 9: 21,007,497 R176Q probably damaging Het
Mtmr3 T C 11: 4,491,067 T528A possibly damaging Het
Mtmr7 A T 8: 40,581,541 N246K probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Necab3 A G 2: 154,555,582 probably null Het
Nr1d1 C T 11: 98,769,884 C419Y probably damaging Het
Nwd1 C A 8: 72,667,300 A397E probably damaging Het
Oas1f A T 5: 120,848,327 K114N probably damaging Het
Olfr1136 T A 2: 87,693,643 K80* probably null Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr395 C A 11: 73,906,911 V194F possibly damaging Het
Olfr46 T A 7: 140,610,698 C169* probably null Het
Olfr613 G T 7: 103,552,154 R123L probably benign Het
Osbpl8 T C 10: 111,291,496 S814P probably benign Het
Pcdhgb7 A T 18: 37,753,130 Q451L probably benign Het
Pde7b C T 10: 20,418,792 R300Q probably damaging Het
Pgghg A G 7: 140,941,496 probably null Het
Plcg1 A G 2: 160,747,768 probably benign Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppt2 A G 17: 34,625,901 V123A probably benign Het
Prdx5 G T 19: 6,906,973 probably benign Het
Prpf40b A G 15: 99,316,316 D819G probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Rab3gap1 T C 1: 127,942,419 C919R probably benign Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rec8 C T 14: 55,624,758 R480C probably damaging Het
Reg3d A G 6: 78,377,459 L53S probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Scn2a T C 2: 65,752,027 V1573A probably benign Het
Selenoo G T 15: 89,095,707 G353* probably null Het
Siva1 A G 12: 112,645,067 Y34C probably damaging Het
Slc2a4 C T 11: 69,944,774 probably benign Het
Slc39a12 A T 2: 14,400,325 T243S probably benign Het
Slc9b2 T C 3: 135,332,518 I453T probably damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Tbc1d24 A T 17: 24,208,891 D32E probably benign Het
Tet1 T A 10: 62,819,474 H1556L possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Ttn A T 2: 76,900,952 probably benign Het
Uimc1 A T 13: 55,077,494 L89H probably damaging Het
Vipas39 A G 12: 87,244,543 I343T probably damaging Het
Vmn2r71 G T 7: 85,620,609 V443L probably benign Het
Zbtb14 G A 17: 69,388,347 D347N possibly damaging Het
Zfp980 G T 4: 145,702,057 C452F probably damaging Het
Zmym5 T A 14: 56,812,236 probably benign Het
Znfx1 T C 2: 167,041,753 T145A possibly damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTGAGCAGTATCAAGCGAG -3'
(R):5'- GTTTGGCTTAGTCTTTAACAGCAG -3'

Sequencing Primer
(F):5'- GCGAGCACACACTCAAGTTTTC -3'
(R):5'- GTCTTTAACAGCAGCAATAGTGGCC -3'
Posted On2015-09-25