Incidental Mutation 'R4622:Baz1a'
ID 346262
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Gtl5, Wcrf180, Acf1
MMRRC Submission 041887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4622 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54939774-55061133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 54988300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 283 (I283K)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably benign
Transcript: ENSMUST00000038926
AA Change: I283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: I283K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173176
AA Change: I66K
Predicted Effect probably benign
Transcript: ENSMUST00000173433
AA Change: I283K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: I283K

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,474 (GRCm39) N26Y probably damaging Het
Aass C T 6: 23,092,329 (GRCm39) D194N probably damaging Het
Acp7 T C 7: 28,313,822 (GRCm39) Y404C probably damaging Het
Acsl1 A T 8: 46,979,410 (GRCm39) I421L probably benign Het
Adgrb3 A T 1: 25,865,569 (GRCm39) D91E probably damaging Het
Adgrg3 T C 8: 95,767,153 (GRCm39) S503P probably damaging Het
Adgrg6 A T 10: 14,317,243 (GRCm39) C526S probably damaging Het
Arhgap32 A T 9: 32,150,644 (GRCm39) I15F possibly damaging Het
Arid1b G T 17: 5,045,325 (GRCm39) probably benign Het
Asnsd1 A G 1: 53,387,378 (GRCm39) V83A probably benign Het
Atg101 A G 15: 101,191,213 (GRCm39) probably benign Het
Atp8a1 T C 5: 67,840,056 (GRCm39) probably benign Het
Aurkb T A 11: 68,939,188 (GRCm39) L137Q probably damaging Het
AY702103 A T 17: 50,547,029 (GRCm39) noncoding transcript Het
B3gnt9 A G 8: 105,980,477 (GRCm39) S304P probably benign Het
Babam2 T C 5: 32,164,656 (GRCm39) V310A probably damaging Het
Batf A G 12: 85,755,327 (GRCm39) D60G possibly damaging Het
Bmerb1 A C 16: 13,911,786 (GRCm39) E44A possibly damaging Het
Bst1 T G 5: 43,976,261 (GRCm39) probably benign Het
C2 C A 17: 35,082,650 (GRCm39) V490L probably damaging Het
Cacna1e T C 1: 154,347,311 (GRCm39) E952G possibly damaging Het
Ccnyl1 A G 1: 64,757,417 (GRCm39) D262G probably damaging Het
Cdc42bpa A T 1: 179,902,223 (GRCm39) K493N probably damaging Het
Cenpe A G 3: 134,949,469 (GRCm39) T85A probably benign Het
Ces2e T A 8: 105,655,341 (GRCm39) probably null Het
Chd3 T A 11: 69,239,834 (GRCm39) R1665W probably damaging Het
Cpm A G 10: 117,506,202 (GRCm39) N188D possibly damaging Het
Cspg4b A G 13: 113,456,615 (GRCm39) D887G probably benign Het
Ctnnd2 A T 15: 30,887,315 (GRCm39) M781L probably benign Het
Ctnnd2 A G 15: 31,009,259 (GRCm39) T1094A probably benign Het
Cux1 T C 5: 136,337,154 (GRCm39) K657R probably damaging Het
Ddx54 G A 5: 120,764,488 (GRCm39) V732M probably damaging Het
Ecrg4 G T 1: 43,781,481 (GRCm39) R121L possibly damaging Het
Efna5 T C 17: 62,958,040 (GRCm39) D72G probably benign Het
Eva1c T A 16: 90,694,343 (GRCm39) probably null Het
Evi5l T C 8: 4,252,909 (GRCm39) probably benign Het
Fasl A G 1: 161,614,703 (GRCm39) L120P probably benign Het
H2-M9 A T 17: 36,952,716 (GRCm39) probably null Het
Hdgf C A 3: 87,821,884 (GRCm39) N198K possibly damaging Het
Hspa9 A T 18: 35,082,090 (GRCm39) M172K possibly damaging Het
Il1r1 A C 1: 40,351,580 (GRCm39) L406F probably damaging Het
Il31 T C 5: 123,618,498 (GRCm39) D96G probably damaging Het
Inhbc A G 10: 127,193,146 (GRCm39) I290T probably benign Het
Lrp2 A T 2: 69,290,693 (GRCm39) V3589D possibly damaging Het
Lrrc14 A T 15: 76,600,540 (GRCm39) probably benign Het
Lyst G A 13: 13,848,983 (GRCm39) A2057T probably benign Het
Macf1 A G 4: 123,266,141 (GRCm39) probably null Het
Mapk10 C A 5: 103,137,590 (GRCm39) G209V probably damaging Het
Mcoln1 A G 8: 3,555,923 (GRCm39) I73V probably damaging Het
Met G T 6: 17,513,383 (GRCm39) R411L probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl4 G A 9: 20,918,793 (GRCm39) R176Q probably damaging Het
Mrtfb G A 16: 13,150,570 (GRCm39) G102D probably damaging Het
Mtmr3 T C 11: 4,441,067 (GRCm39) T528A possibly damaging Het
Mtmr7 A T 8: 41,034,583 (GRCm39) N246K probably damaging Het
Mycbp2 G T 14: 103,457,415 (GRCm39) T1627K probably benign Het
Necab3 A G 2: 154,397,502 (GRCm39) probably null Het
Nr1d1 C T 11: 98,660,710 (GRCm39) C419Y probably damaging Het
Nwd1 C A 8: 73,393,928 (GRCm39) A397E probably damaging Het
Oas1f A T 5: 120,986,390 (GRCm39) K114N probably damaging Het
Or13a18 T A 7: 140,190,611 (GRCm39) C169* probably null Het
Or1e35 C A 11: 73,797,737 (GRCm39) V194F possibly damaging Het
Or51ab3 G T 7: 103,201,361 (GRCm39) R123L probably benign Het
Or5k8 A T 16: 58,644,469 (GRCm39) I201N possibly damaging Het
Or5w13 T A 2: 87,523,987 (GRCm39) K80* probably null Het
Osbpl8 T C 10: 111,127,357 (GRCm39) S814P probably benign Het
Pcdhgb7 A T 18: 37,886,183 (GRCm39) Q451L probably benign Het
Pde7b C T 10: 20,294,538 (GRCm39) R300Q probably damaging Het
Pgghg A G 7: 140,521,409 (GRCm39) probably null Het
Plcg1 A G 2: 160,589,688 (GRCm39) probably benign Het
Plxna2 A T 1: 194,494,458 (GRCm39) I1892L probably benign Het
Ppt2 A G 17: 34,844,875 (GRCm39) V123A probably benign Het
Prdx5 G T 19: 6,884,341 (GRCm39) probably benign Het
Prpf40b A G 15: 99,214,197 (GRCm39) D819G probably benign Het
Prss3l A T 6: 41,422,246 (GRCm39) I53N probably damaging Het
Psap T G 10: 60,136,630 (GRCm39) C536W probably damaging Het
Rab3gap1 T C 1: 127,870,156 (GRCm39) C919R probably benign Het
Racgap1 C A 15: 99,524,087 (GRCm39) S440I probably benign Het
Rec8 C T 14: 55,862,215 (GRCm39) R480C probably damaging Het
Reg3d A G 6: 78,354,442 (GRCm39) L53S probably benign Het
Rnft2 T A 5: 118,370,471 (GRCm39) S244C probably damaging Het
Scn2a T C 2: 65,582,371 (GRCm39) V1573A probably benign Het
Selenoo G T 15: 88,979,910 (GRCm39) G353* probably null Het
Siva1 A G 12: 112,611,501 (GRCm39) Y34C probably damaging Het
Slc2a4 C T 11: 69,835,600 (GRCm39) probably benign Het
Slc39a12 A T 2: 14,405,136 (GRCm39) T243S probably benign Het
Slc9b2 T C 3: 135,038,279 (GRCm39) I453T probably damaging Het
Spag17 A G 3: 100,010,559 (GRCm39) T2018A probably benign Het
Tbc1d24 A T 17: 24,427,865 (GRCm39) D32E probably benign Het
Tet1 T A 10: 62,655,253 (GRCm39) H1556L possibly damaging Het
Tmem59 A T 4: 107,047,915 (GRCm39) probably benign Het
Ttn A T 2: 76,731,296 (GRCm39) probably benign Het
Uimc1 A T 13: 55,225,307 (GRCm39) L89H probably damaging Het
Vipas39 A G 12: 87,291,317 (GRCm39) I343T probably damaging Het
Vmn2r71 G T 7: 85,269,817 (GRCm39) V443L probably benign Het
Zbtb14 G A 17: 69,695,342 (GRCm39) D347N possibly damaging Het
Zfp980 G T 4: 145,428,627 (GRCm39) C452F probably damaging Het
Zmym5 T A 14: 57,049,693 (GRCm39) probably benign Het
Znfx1 T C 2: 166,883,673 (GRCm39) T145A possibly damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54,963,516 (GRCm39) missense probably benign
IGL01138:Baz1a APN 12 54,977,110 (GRCm39) missense probably damaging 1.00
IGL01298:Baz1a APN 12 55,001,594 (GRCm39) missense probably damaging 1.00
IGL02639:Baz1a APN 12 54,942,810 (GRCm39) splice site probably benign
IGL02995:Baz1a APN 12 54,947,232 (GRCm39) missense probably damaging 1.00
IGL03001:Baz1a APN 12 54,969,896 (GRCm39) missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54,941,743 (GRCm39) missense probably damaging 1.00
IGL03135:Baz1a APN 12 54,976,375 (GRCm39) missense probably damaging 1.00
IGL03151:Baz1a APN 12 54,955,934 (GRCm39) critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54,945,320 (GRCm39) missense probably damaging 1.00
IGL03240:Baz1a APN 12 54,974,352 (GRCm39) nonsense probably null
Bezos UTSW 12 54,941,816 (GRCm39) nonsense probably null
Flavia UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
gumdrops UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
Kilter UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
Kisses UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
liverlips UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
smooch UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
Smootch UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54,977,095 (GRCm39) missense probably benign 0.03
R0127:Baz1a UTSW 12 54,945,491 (GRCm39) missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54,958,172 (GRCm39) missense probably damaging 1.00
R0393:Baz1a UTSW 12 54,965,221 (GRCm39) critical splice donor site probably null
R0532:Baz1a UTSW 12 54,981,605 (GRCm39) missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54,988,304 (GRCm39) nonsense probably null
R0626:Baz1a UTSW 12 55,022,055 (GRCm39) missense probably damaging 0.99
R0654:Baz1a UTSW 12 54,958,182 (GRCm39) missense probably benign 0.01
R0782:Baz1a UTSW 12 54,941,273 (GRCm39) missense probably damaging 1.00
R0826:Baz1a UTSW 12 54,977,097 (GRCm39) nonsense probably null
R0855:Baz1a UTSW 12 54,947,348 (GRCm39) splice site probably benign
R0927:Baz1a UTSW 12 54,941,773 (GRCm39) missense probably damaging 1.00
R0941:Baz1a UTSW 12 54,945,216 (GRCm39) missense probably benign 0.00
R1079:Baz1a UTSW 12 54,941,785 (GRCm39) missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54,976,349 (GRCm39) missense probably damaging 1.00
R1647:Baz1a UTSW 12 55,021,983 (GRCm39) missense probably damaging 1.00
R1731:Baz1a UTSW 12 54,965,330 (GRCm39) missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54,945,573 (GRCm39) nonsense probably null
R1762:Baz1a UTSW 12 54,955,805 (GRCm39) missense probably damaging 1.00
R1770:Baz1a UTSW 12 54,945,293 (GRCm39) missense probably damaging 1.00
R1968:Baz1a UTSW 12 54,947,122 (GRCm39) missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54,976,431 (GRCm39) missense probably damaging 1.00
R2111:Baz1a UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
R2215:Baz1a UTSW 12 55,022,154 (GRCm39) nonsense probably null
R2282:Baz1a UTSW 12 54,963,597 (GRCm39) nonsense probably null
R2875:Baz1a UTSW 12 54,969,904 (GRCm39) missense probably damaging 1.00
R2890:Baz1a UTSW 12 54,945,302 (GRCm39) missense probably benign
R2971:Baz1a UTSW 12 54,970,224 (GRCm39) missense probably damaging 1.00
R3404:Baz1a UTSW 12 54,963,774 (GRCm39) missense probably benign 0.00
R3419:Baz1a UTSW 12 54,993,684 (GRCm39) missense probably benign 0.05
R3699:Baz1a UTSW 12 54,963,831 (GRCm39) missense probably benign 0.09
R3899:Baz1a UTSW 12 54,981,589 (GRCm39) missense probably benign 0.01
R3927:Baz1a UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54,976,404 (GRCm39) missense probably benign 0.00
R4072:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R4196:Baz1a UTSW 12 54,958,200 (GRCm39) missense probably damaging 1.00
R4289:Baz1a UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
R4455:Baz1a UTSW 12 54,958,153 (GRCm39) missense probably benign 0.26
R4583:Baz1a UTSW 12 54,969,325 (GRCm39) missense probably damaging 0.99
R4807:Baz1a UTSW 12 54,945,267 (GRCm39) missense probably benign 0.28
R4998:Baz1a UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
R5239:Baz1a UTSW 12 54,945,129 (GRCm39) missense probably damaging 0.99
R5379:Baz1a UTSW 12 54,941,133 (GRCm39) missense probably damaging 1.00
R5408:Baz1a UTSW 12 54,969,835 (GRCm39) missense probably damaging 1.00
R5678:Baz1a UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
R5810:Baz1a UTSW 12 54,974,500 (GRCm39) intron probably benign
R6092:Baz1a UTSW 12 54,955,868 (GRCm39) missense possibly damaging 0.88
R6317:Baz1a UTSW 12 55,001,585 (GRCm39) missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54,965,339 (GRCm39) missense probably benign 0.01
R6803:Baz1a UTSW 12 54,988,340 (GRCm39) missense probably null 0.99
R7185:Baz1a UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
R7248:Baz1a UTSW 12 54,947,293 (GRCm39) missense probably damaging 1.00
R7392:Baz1a UTSW 12 54,945,550 (GRCm39) missense probably damaging 1.00
R8009:Baz1a UTSW 12 54,941,816 (GRCm39) nonsense probably null
R8025:Baz1a UTSW 12 54,955,921 (GRCm39) missense probably benign 0.34
R8392:Baz1a UTSW 12 54,969,908 (GRCm39) missense probably damaging 1.00
R8862:Baz1a UTSW 12 55,032,624 (GRCm39) unclassified probably benign
R8949:Baz1a UTSW 12 54,941,238 (GRCm39) missense probably damaging 1.00
R9340:Baz1a UTSW 12 54,963,372 (GRCm39) missense probably damaging 0.97
R9389:Baz1a UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
R9401:Baz1a UTSW 12 54,963,339 (GRCm39) missense probably damaging 1.00
R9666:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R9722:Baz1a UTSW 12 54,946,882 (GRCm39) missense probably benign 0.43
R9746:Baz1a UTSW 12 55,021,895 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGCAGTATCAAGCGAG -3'
(R):5'- GTTTGGCTTAGTCTTTAACAGCAG -3'

Sequencing Primer
(F):5'- GCGAGCACACACTCAAGTTTTC -3'
(R):5'- GTCTTTAACAGCAGCAATAGTGGCC -3'
Posted On 2015-09-25