Incidental Mutation 'R4622:Lyst'
ID 346265
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 041887-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.414) question?
Stock # R4622 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 13764982-13953388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13848983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2057 (A2057T)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: A2057T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: A2057T

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,474 (GRCm39) N26Y probably damaging Het
Aass C T 6: 23,092,329 (GRCm39) D194N probably damaging Het
Acp7 T C 7: 28,313,822 (GRCm39) Y404C probably damaging Het
Acsl1 A T 8: 46,979,410 (GRCm39) I421L probably benign Het
Adgrb3 A T 1: 25,865,569 (GRCm39) D91E probably damaging Het
Adgrg3 T C 8: 95,767,153 (GRCm39) S503P probably damaging Het
Adgrg6 A T 10: 14,317,243 (GRCm39) C526S probably damaging Het
Arhgap32 A T 9: 32,150,644 (GRCm39) I15F possibly damaging Het
Arid1b G T 17: 5,045,325 (GRCm39) probably benign Het
Asnsd1 A G 1: 53,387,378 (GRCm39) V83A probably benign Het
Atg101 A G 15: 101,191,213 (GRCm39) probably benign Het
Atp8a1 T C 5: 67,840,056 (GRCm39) probably benign Het
Aurkb T A 11: 68,939,188 (GRCm39) L137Q probably damaging Het
AY702103 A T 17: 50,547,029 (GRCm39) noncoding transcript Het
B3gnt9 A G 8: 105,980,477 (GRCm39) S304P probably benign Het
Babam2 T C 5: 32,164,656 (GRCm39) V310A probably damaging Het
Batf A G 12: 85,755,327 (GRCm39) D60G possibly damaging Het
Baz1a A T 12: 54,988,300 (GRCm39) I283K probably benign Het
Bmerb1 A C 16: 13,911,786 (GRCm39) E44A possibly damaging Het
Bst1 T G 5: 43,976,261 (GRCm39) probably benign Het
C2 C A 17: 35,082,650 (GRCm39) V490L probably damaging Het
Cacna1e T C 1: 154,347,311 (GRCm39) E952G possibly damaging Het
Ccnyl1 A G 1: 64,757,417 (GRCm39) D262G probably damaging Het
Cdc42bpa A T 1: 179,902,223 (GRCm39) K493N probably damaging Het
Cenpe A G 3: 134,949,469 (GRCm39) T85A probably benign Het
Ces2e T A 8: 105,655,341 (GRCm39) probably null Het
Chd3 T A 11: 69,239,834 (GRCm39) R1665W probably damaging Het
Cpm A G 10: 117,506,202 (GRCm39) N188D possibly damaging Het
Cspg4b A G 13: 113,456,615 (GRCm39) D887G probably benign Het
Ctnnd2 A T 15: 30,887,315 (GRCm39) M781L probably benign Het
Ctnnd2 A G 15: 31,009,259 (GRCm39) T1094A probably benign Het
Cux1 T C 5: 136,337,154 (GRCm39) K657R probably damaging Het
Ddx54 G A 5: 120,764,488 (GRCm39) V732M probably damaging Het
Ecrg4 G T 1: 43,781,481 (GRCm39) R121L possibly damaging Het
Efna5 T C 17: 62,958,040 (GRCm39) D72G probably benign Het
Eva1c T A 16: 90,694,343 (GRCm39) probably null Het
Evi5l T C 8: 4,252,909 (GRCm39) probably benign Het
Fasl A G 1: 161,614,703 (GRCm39) L120P probably benign Het
H2-M9 A T 17: 36,952,716 (GRCm39) probably null Het
Hdgf C A 3: 87,821,884 (GRCm39) N198K possibly damaging Het
Hspa9 A T 18: 35,082,090 (GRCm39) M172K possibly damaging Het
Il1r1 A C 1: 40,351,580 (GRCm39) L406F probably damaging Het
Il31 T C 5: 123,618,498 (GRCm39) D96G probably damaging Het
Inhbc A G 10: 127,193,146 (GRCm39) I290T probably benign Het
Lrp2 A T 2: 69,290,693 (GRCm39) V3589D possibly damaging Het
Lrrc14 A T 15: 76,600,540 (GRCm39) probably benign Het
Macf1 A G 4: 123,266,141 (GRCm39) probably null Het
Mapk10 C A 5: 103,137,590 (GRCm39) G209V probably damaging Het
Mcoln1 A G 8: 3,555,923 (GRCm39) I73V probably damaging Het
Met G T 6: 17,513,383 (GRCm39) R411L probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl4 G A 9: 20,918,793 (GRCm39) R176Q probably damaging Het
Mrtfb G A 16: 13,150,570 (GRCm39) G102D probably damaging Het
Mtmr3 T C 11: 4,441,067 (GRCm39) T528A possibly damaging Het
Mtmr7 A T 8: 41,034,583 (GRCm39) N246K probably damaging Het
Mycbp2 G T 14: 103,457,415 (GRCm39) T1627K probably benign Het
Necab3 A G 2: 154,397,502 (GRCm39) probably null Het
Nr1d1 C T 11: 98,660,710 (GRCm39) C419Y probably damaging Het
Nwd1 C A 8: 73,393,928 (GRCm39) A397E probably damaging Het
Oas1f A T 5: 120,986,390 (GRCm39) K114N probably damaging Het
Or13a18 T A 7: 140,190,611 (GRCm39) C169* probably null Het
Or1e35 C A 11: 73,797,737 (GRCm39) V194F possibly damaging Het
Or51ab3 G T 7: 103,201,361 (GRCm39) R123L probably benign Het
Or5k8 A T 16: 58,644,469 (GRCm39) I201N possibly damaging Het
Or5w13 T A 2: 87,523,987 (GRCm39) K80* probably null Het
Osbpl8 T C 10: 111,127,357 (GRCm39) S814P probably benign Het
Pcdhgb7 A T 18: 37,886,183 (GRCm39) Q451L probably benign Het
Pde7b C T 10: 20,294,538 (GRCm39) R300Q probably damaging Het
Pgghg A G 7: 140,521,409 (GRCm39) probably null Het
Plcg1 A G 2: 160,589,688 (GRCm39) probably benign Het
Plxna2 A T 1: 194,494,458 (GRCm39) I1892L probably benign Het
Ppt2 A G 17: 34,844,875 (GRCm39) V123A probably benign Het
Prdx5 G T 19: 6,884,341 (GRCm39) probably benign Het
Prpf40b A G 15: 99,214,197 (GRCm39) D819G probably benign Het
Prss3l A T 6: 41,422,246 (GRCm39) I53N probably damaging Het
Psap T G 10: 60,136,630 (GRCm39) C536W probably damaging Het
Rab3gap1 T C 1: 127,870,156 (GRCm39) C919R probably benign Het
Racgap1 C A 15: 99,524,087 (GRCm39) S440I probably benign Het
Rec8 C T 14: 55,862,215 (GRCm39) R480C probably damaging Het
Reg3d A G 6: 78,354,442 (GRCm39) L53S probably benign Het
Rnft2 T A 5: 118,370,471 (GRCm39) S244C probably damaging Het
Scn2a T C 2: 65,582,371 (GRCm39) V1573A probably benign Het
Selenoo G T 15: 88,979,910 (GRCm39) G353* probably null Het
Siva1 A G 12: 112,611,501 (GRCm39) Y34C probably damaging Het
Slc2a4 C T 11: 69,835,600 (GRCm39) probably benign Het
Slc39a12 A T 2: 14,405,136 (GRCm39) T243S probably benign Het
Slc9b2 T C 3: 135,038,279 (GRCm39) I453T probably damaging Het
Spag17 A G 3: 100,010,559 (GRCm39) T2018A probably benign Het
Tbc1d24 A T 17: 24,427,865 (GRCm39) D32E probably benign Het
Tet1 T A 10: 62,655,253 (GRCm39) H1556L possibly damaging Het
Tmem59 A T 4: 107,047,915 (GRCm39) probably benign Het
Ttn A T 2: 76,731,296 (GRCm39) probably benign Het
Uimc1 A T 13: 55,225,307 (GRCm39) L89H probably damaging Het
Vipas39 A G 12: 87,291,317 (GRCm39) I343T probably damaging Het
Vmn2r71 G T 7: 85,269,817 (GRCm39) V443L probably benign Het
Zbtb14 G A 17: 69,695,342 (GRCm39) D347N possibly damaging Het
Zfp980 G T 4: 145,428,627 (GRCm39) C452F probably damaging Het
Zmym5 T A 14: 57,049,693 (GRCm39) probably benign Het
Znfx1 T C 2: 166,883,673 (GRCm39) T145A possibly damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13,823,463 (GRCm39) missense probably benign
IGL00474:Lyst APN 13 13,818,121 (GRCm39) missense possibly damaging 0.48
IGL00484:Lyst APN 13 13,884,188 (GRCm39) missense probably benign 0.02
IGL00492:Lyst APN 13 13,852,760 (GRCm39) missense possibly damaging 0.54
IGL00807:Lyst APN 13 13,825,008 (GRCm39) missense possibly damaging 0.91
IGL00949:Lyst APN 13 13,810,070 (GRCm39) missense possibly damaging 0.87
IGL00952:Lyst APN 13 13,852,692 (GRCm39) missense probably benign 0.05
IGL01305:Lyst APN 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL01317:Lyst APN 13 13,845,455 (GRCm39) missense probably benign
IGL01419:Lyst APN 13 13,810,423 (GRCm39) missense probably benign 0.00
IGL01445:Lyst APN 13 13,826,299 (GRCm39) missense probably benign 0.00
IGL01690:Lyst APN 13 13,917,831 (GRCm39) missense probably damaging 1.00
IGL01791:Lyst APN 13 13,809,887 (GRCm39) missense probably damaging 1.00
IGL01809:Lyst APN 13 13,812,388 (GRCm39) missense probably damaging 1.00
IGL01896:Lyst APN 13 13,810,162 (GRCm39) missense probably benign 0.04
IGL01938:Lyst APN 13 13,812,009 (GRCm39) missense possibly damaging 0.93
IGL01986:Lyst APN 13 13,950,212 (GRCm39) critical splice donor site probably null
IGL02022:Lyst APN 13 13,838,629 (GRCm39) nonsense probably null
IGL02044:Lyst APN 13 13,887,431 (GRCm39) missense probably damaging 1.00
IGL02157:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02185:Lyst APN 13 13,835,678 (GRCm39) nonsense probably null
IGL02215:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02245:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02246:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02247:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02297:Lyst APN 13 13,812,677 (GRCm39) nonsense probably null
IGL02411:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02415:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02419:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02420:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02429:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02501:Lyst APN 13 13,886,230 (GRCm39) missense probably benign 0.02
IGL02522:Lyst APN 13 13,809,290 (GRCm39) missense possibly damaging 0.81
IGL02535:Lyst APN 13 13,824,927 (GRCm39) missense probably benign 0.00
IGL02596:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02601:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02603:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02608:Lyst APN 13 13,887,339 (GRCm39) missense probably damaging 0.98
IGL02622:Lyst APN 13 13,855,975 (GRCm39) missense probably damaging 1.00
IGL02690:Lyst APN 13 13,815,710 (GRCm39) missense possibly damaging 0.58
IGL02715:Lyst APN 13 13,848,905 (GRCm39) splice site probably null
IGL02725:Lyst APN 13 13,935,412 (GRCm39) missense probably damaging 1.00
IGL02729:Lyst APN 13 13,921,194 (GRCm39) missense possibly damaging 0.95
IGL02729:Lyst APN 13 13,848,924 (GRCm39) missense possibly damaging 0.81
IGL02820:Lyst APN 13 13,812,643 (GRCm39) missense probably benign 0.03
IGL02945:Lyst APN 13 13,935,783 (GRCm39) missense possibly damaging 0.48
IGL02981:Lyst APN 13 13,809,496 (GRCm39) missense probably damaging 0.99
IGL03087:Lyst APN 13 13,809,641 (GRCm39) missense probably damaging 1.00
IGL03149:Lyst APN 13 13,856,029 (GRCm39) missense probably benign 0.14
IGL03158:Lyst APN 13 13,826,337 (GRCm39) critical splice donor site probably null
IGL03226:Lyst APN 13 13,884,144 (GRCm39) missense probably benign 0.01
IGL03242:Lyst APN 13 13,831,466 (GRCm39) nonsense probably null
IGL03385:Lyst APN 13 13,831,565 (GRCm39) nonsense probably null
50-cal UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
charcoal UTSW 13 13,871,346 (GRCm39) nonsense probably null
charlotte_gray UTSW 13 13,602,026 (GRCm38) intron probably benign
charzard UTSW 13 13,821,668 (GRCm39) nonsense probably null
grey_wolf UTSW 13 0 () unclassified
lightspeed UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
pardon UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
robin UTSW 13 13,823,387 (GRCm39) nonsense probably null
sooty UTSW 13 0 () unclassified
souris UTSW 13 13,857,808 (GRCm39) unclassified probably benign
Swallow UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
vulpix UTSW 13 13,871,379 (GRCm39) splice site probably null
ANU22:Lyst UTSW 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL02835:Lyst UTSW 13 13,835,685 (GRCm39) missense possibly damaging 0.82
P0031:Lyst UTSW 13 13,838,616 (GRCm39) missense probably damaging 1.00
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0031:Lyst UTSW 13 13,882,741 (GRCm39) missense probably benign 0.14
R0115:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0212:Lyst UTSW 13 13,810,570 (GRCm39) missense possibly damaging 0.93
R0386:Lyst UTSW 13 13,882,799 (GRCm39) splice site probably benign
R0393:Lyst UTSW 13 13,821,664 (GRCm39) missense probably benign 0.01
R0415:Lyst UTSW 13 13,886,195 (GRCm39) splice site probably benign
R0446:Lyst UTSW 13 13,812,633 (GRCm39) missense probably benign 0.00
R0481:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0499:Lyst UTSW 13 13,791,298 (GRCm39) missense probably damaging 1.00
R0506:Lyst UTSW 13 13,812,600 (GRCm39) missense probably benign
R0530:Lyst UTSW 13 13,931,891 (GRCm39) splice site probably benign
R0541:Lyst UTSW 13 13,855,878 (GRCm39) missense probably benign 0.00
R0570:Lyst UTSW 13 13,883,971 (GRCm39) missense probably benign 0.26
R0680:Lyst UTSW 13 13,824,926 (GRCm39) missense probably benign 0.01
R0842:Lyst UTSW 13 13,852,826 (GRCm39) nonsense probably null
R0848:Lyst UTSW 13 13,809,515 (GRCm39) missense probably benign 0.00
R1014:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.49
R1205:Lyst UTSW 13 13,854,787 (GRCm39) missense probably benign
R1251:Lyst UTSW 13 13,809,068 (GRCm39) missense probably benign 0.00
R1304:Lyst UTSW 13 13,926,569 (GRCm39) nonsense probably null
R1398:Lyst UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
R1445:Lyst UTSW 13 13,814,639 (GRCm39) missense possibly damaging 0.94
R1475:Lyst UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
R1479:Lyst UTSW 13 13,809,067 (GRCm39) missense probably benign 0.00
R1484:Lyst UTSW 13 13,852,775 (GRCm39) missense probably benign 0.01
R1498:Lyst UTSW 13 13,824,960 (GRCm39) missense possibly damaging 0.49
R1540:Lyst UTSW 13 13,809,686 (GRCm39) missense possibly damaging 0.81
R1611:Lyst UTSW 13 13,809,482 (GRCm39) missense probably damaging 0.97
R1653:Lyst UTSW 13 13,809,811 (GRCm39) missense probably damaging 1.00
R1669:Lyst UTSW 13 13,818,672 (GRCm39) missense possibly damaging 0.90
R1686:Lyst UTSW 13 13,809,290 (GRCm39) missense possibly damaging 0.81
R1694:Lyst UTSW 13 13,835,746 (GRCm39) missense probably damaging 0.98
R1747:Lyst UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
R1793:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R1871:Lyst UTSW 13 13,826,297 (GRCm39) missense probably benign 0.00
R1905:Lyst UTSW 13 13,808,719 (GRCm39) missense probably benign
R1958:Lyst UTSW 13 13,791,203 (GRCm39) missense probably damaging 1.00
R1969:Lyst UTSW 13 13,904,929 (GRCm39) missense probably damaging 0.99
R2040:Lyst UTSW 13 13,815,807 (GRCm39) missense probably benign 0.00
R2109:Lyst UTSW 13 13,887,405 (GRCm39) missense possibly damaging 0.46
R2116:Lyst UTSW 13 13,810,286 (GRCm39) missense probably damaging 0.99
R2121:Lyst UTSW 13 13,835,556 (GRCm39) missense probably damaging 1.00
R2127:Lyst UTSW 13 13,809,847 (GRCm39) missense probably damaging 1.00
R2187:Lyst UTSW 13 13,883,926 (GRCm39) missense possibly damaging 0.61
R2238:Lyst UTSW 13 13,917,848 (GRCm39) missense probably benign 0.41
R2258:Lyst UTSW 13 13,812,243 (GRCm39) missense probably benign 0.00
R2292:Lyst UTSW 13 13,915,080 (GRCm39) missense probably damaging 1.00
R2368:Lyst UTSW 13 13,871,248 (GRCm39) missense probably damaging 0.96
R2908:Lyst UTSW 13 13,844,458 (GRCm39) missense probably benign 0.03
R3001:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3002:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3024:Lyst UTSW 13 13,833,272 (GRCm39) missense probably benign
R3113:Lyst UTSW 13 13,844,512 (GRCm39) missense probably benign 0.12
R3406:Lyst UTSW 13 13,809,815 (GRCm39) missense possibly damaging 0.56
R3972:Lyst UTSW 13 13,881,210 (GRCm39) missense possibly damaging 0.67
R3978:Lyst UTSW 13 13,808,753 (GRCm39) missense possibly damaging 0.82
R4032:Lyst UTSW 13 13,791,250 (GRCm39) missense probably damaging 1.00
R4192:Lyst UTSW 13 13,915,098 (GRCm39) missense probably damaging 1.00
R4206:Lyst UTSW 13 13,810,574 (GRCm39) missense probably benign 0.03
R4298:Lyst UTSW 13 13,809,472 (GRCm39) missense probably damaging 1.00
R4344:Lyst UTSW 13 13,873,051 (GRCm39) missense probably benign 0.06
R4441:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4445:Lyst UTSW 13 13,884,149 (GRCm39) missense probably benign 0.42
R4477:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4493:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4494:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4495:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4638:Lyst UTSW 13 13,871,379 (GRCm39) splice site probably null
R4658:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4675:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4719:Lyst UTSW 13 13,824,935 (GRCm39) missense probably benign
R4729:Lyst UTSW 13 13,812,486 (GRCm39) missense probably damaging 1.00
R4774:Lyst UTSW 13 13,915,182 (GRCm39) missense probably damaging 1.00
R4811:Lyst UTSW 13 13,951,685 (GRCm39) missense probably benign 0.33
R4877:Lyst UTSW 13 13,857,734 (GRCm39) missense probably damaging 1.00
R4920:Lyst UTSW 13 13,821,645 (GRCm39) missense possibly damaging 0.79
R4933:Lyst UTSW 13 13,933,963 (GRCm39) missense probably benign 0.12
R4933:Lyst UTSW 13 13,812,349 (GRCm39) missense probably damaging 0.98
R4958:Lyst UTSW 13 13,810,048 (GRCm39) missense probably benign 0.00
R4982:Lyst UTSW 13 13,900,539 (GRCm39) missense probably damaging 1.00
R4992:Lyst UTSW 13 13,835,748 (GRCm39) missense probably damaging 1.00
R5024:Lyst UTSW 13 13,808,989 (GRCm39) missense probably benign
R5049:Lyst UTSW 13 13,810,649 (GRCm39) missense probably damaging 1.00
R5079:Lyst UTSW 13 13,931,938 (GRCm39) missense probably benign 0.08
R5254:Lyst UTSW 13 13,857,655 (GRCm39) missense probably benign 0.00
R5266:Lyst UTSW 13 13,835,555 (GRCm39) missense probably damaging 1.00
R5279:Lyst UTSW 13 13,823,387 (GRCm39) nonsense probably null
R5285:Lyst UTSW 13 13,809,011 (GRCm39) missense probably benign 0.01
R5364:Lyst UTSW 13 13,831,439 (GRCm39) missense probably benign 0.35
R5435:Lyst UTSW 13 13,951,649 (GRCm39) missense possibly damaging 0.64
R5516:Lyst UTSW 13 13,818,707 (GRCm39) missense probably benign 0.10
R5524:Lyst UTSW 13 13,921,364 (GRCm39) missense probably benign 0.03
R5591:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5592:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5593:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,933,982 (GRCm39) missense probably benign 0.00
R5644:Lyst UTSW 13 13,812,081 (GRCm39) missense possibly damaging 0.58
R5659:Lyst UTSW 13 13,809,212 (GRCm39) missense possibly damaging 0.58
R5741:Lyst UTSW 13 13,808,615 (GRCm39) missense probably benign 0.44
R5908:Lyst UTSW 13 13,871,346 (GRCm39) nonsense probably null
R5969:Lyst UTSW 13 13,862,398 (GRCm39) splice site probably null
R6128:Lyst UTSW 13 13,933,964 (GRCm39) missense possibly damaging 0.67
R6271:Lyst UTSW 13 13,833,339 (GRCm39) missense probably benign 0.30
R6315:Lyst UTSW 13 13,818,089 (GRCm39) missense probably benign
R6318:Lyst UTSW 13 13,917,896 (GRCm39) missense possibly damaging 0.88
R6555:Lyst UTSW 13 13,823,510 (GRCm39) missense probably benign 0.01
R6663:Lyst UTSW 13 13,838,701 (GRCm39) splice site probably null
R6701:Lyst UTSW 13 13,856,070 (GRCm39) missense probably benign 0.06
R6711:Lyst UTSW 13 13,809,820 (GRCm39) missense possibly damaging 0.80
R6909:Lyst UTSW 13 13,917,960 (GRCm39) missense probably damaging 1.00
R6915:Lyst UTSW 13 13,900,629 (GRCm39) missense probably benign 0.01
R6929:Lyst UTSW 13 13,917,909 (GRCm39) missense probably damaging 1.00
R6960:Lyst UTSW 13 13,808,663 (GRCm39) missense probably benign 0.12
R7018:Lyst UTSW 13 13,918,044 (GRCm39) critical splice donor site probably null
R7037:Lyst UTSW 13 13,791,251 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,812,293 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,809,485 (GRCm39) missense probably benign 0.34
R7070:Lyst UTSW 13 13,932,029 (GRCm39) missense probably benign 0.23
R7188:Lyst UTSW 13 13,926,675 (GRCm39) missense possibly damaging 0.66
R7201:Lyst UTSW 13 13,883,885 (GRCm39) nonsense probably null
R7210:Lyst UTSW 13 13,831,568 (GRCm39) missense probably damaging 1.00
R7229:Lyst UTSW 13 13,818,094 (GRCm39) missense probably benign 0.00
R7293:Lyst UTSW 13 13,854,822 (GRCm39) missense probably benign 0.01
R7318:Lyst UTSW 13 13,932,028 (GRCm39) missense probably benign 0.13
R7344:Lyst UTSW 13 13,881,140 (GRCm39) missense probably benign
R7426:Lyst UTSW 13 13,812,109 (GRCm39) missense probably benign
R7522:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R7583:Lyst UTSW 13 13,810,472 (GRCm39) missense probably damaging 1.00
R7606:Lyst UTSW 13 13,812,060 (GRCm39) missense probably damaging 1.00
R7636:Lyst UTSW 13 13,791,332 (GRCm39) critical splice donor site probably null
R7658:Lyst UTSW 13 13,905,061 (GRCm39) missense possibly damaging 0.63
R7685:Lyst UTSW 13 13,844,450 (GRCm39) missense probably benign 0.00
R7689:Lyst UTSW 13 13,857,808 (GRCm39) critical splice donor site probably null
R7765:Lyst UTSW 13 13,884,117 (GRCm39) missense possibly damaging 0.75
R7779:Lyst UTSW 13 13,809,128 (GRCm39) missense probably damaging 1.00
R7871:Lyst UTSW 13 13,810,637 (GRCm39) nonsense probably null
R7872:Lyst UTSW 13 13,810,450 (GRCm39) missense probably benign 0.14
R7884:Lyst UTSW 13 13,882,268 (GRCm39) missense probably benign 0.09
R7890:Lyst UTSW 13 13,915,154 (GRCm39) missense probably damaging 0.99
R7916:Lyst UTSW 13 13,821,657 (GRCm39) missense possibly damaging 0.64
R7948:Lyst UTSW 13 13,921,174 (GRCm39) missense possibly damaging 0.59
R7956:Lyst UTSW 13 13,815,788 (GRCm39) missense possibly damaging 0.80
R8048:Lyst UTSW 13 13,862,230 (GRCm39) missense probably benign 0.12
R8085:Lyst UTSW 13 13,808,894 (GRCm39) missense probably damaging 0.98
R8165:Lyst UTSW 13 13,872,945 (GRCm39) missense probably damaging 0.99
R8235:Lyst UTSW 13 13,935,323 (GRCm39) missense possibly damaging 0.69
R8237:Lyst UTSW 13 13,826,317 (GRCm39) missense probably benign 0.00
R8275:Lyst UTSW 13 13,950,667 (GRCm39) missense probably benign 0.02
R8300:Lyst UTSW 13 13,838,643 (GRCm39) missense possibly damaging 0.79
R8350:Lyst UTSW 13 13,824,973 (GRCm39) nonsense probably null
R8526:Lyst UTSW 13 13,935,391 (GRCm39) missense probably damaging 0.99
R8551:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.77
R8723:Lyst UTSW 13 13,887,342 (GRCm39) missense possibly damaging 0.89
R8772:Lyst UTSW 13 13,812,077 (GRCm39) nonsense probably null
R8778:Lyst UTSW 13 13,903,152 (GRCm39) missense possibly damaging 0.89
R8778:Lyst UTSW 13 13,810,361 (GRCm39) missense possibly damaging 0.89
R8801:Lyst UTSW 13 13,835,595 (GRCm39) missense probably benign 0.10
R8837:Lyst UTSW 13 13,852,548 (GRCm39) missense probably benign
R8874:Lyst UTSW 13 13,812,147 (GRCm39) missense probably benign
R8878:Lyst UTSW 13 13,815,661 (GRCm39) missense probably benign 0.00
R8891:Lyst UTSW 13 13,887,435 (GRCm39) missense possibly damaging 0.67
R9077:Lyst UTSW 13 13,857,693 (GRCm39) missense probably benign 0.02
R9127:Lyst UTSW 13 13,808,827 (GRCm39) missense probably damaging 1.00
R9143:Lyst UTSW 13 13,835,750 (GRCm39) missense probably damaging 0.98
R9216:Lyst UTSW 13 13,823,188 (GRCm39) missense probably benign
R9217:Lyst UTSW 13 13,871,245 (GRCm39) missense probably benign 0.01
R9291:Lyst UTSW 13 13,883,938 (GRCm39) missense probably benign 0.01
R9302:Lyst UTSW 13 13,904,947 (GRCm39) missense possibly damaging 0.46
R9370:Lyst UTSW 13 13,935,333 (GRCm39) missense probably damaging 1.00
R9402:Lyst UTSW 13 13,812,463 (GRCm39) missense probably benign
R9457:Lyst UTSW 13 13,862,330 (GRCm39) missense possibly damaging 0.83
R9481:Lyst UTSW 13 13,857,653 (GRCm39) missense possibly damaging 0.68
R9563:Lyst UTSW 13 13,812,408 (GRCm39) missense probably benign 0.36
R9623:Lyst UTSW 13 13,852,587 (GRCm39) missense probably benign
R9661:Lyst UTSW 13 13,808,779 (GRCm39) missense probably benign 0.01
R9682:Lyst UTSW 13 13,831,526 (GRCm39) missense probably benign 0.21
R9743:Lyst UTSW 13 13,809,323 (GRCm39) missense possibly damaging 0.67
R9801:Lyst UTSW 13 13,809,290 (GRCm39) missense probably damaging 0.97
RF001:Lyst UTSW 13 13,810,426 (GRCm39) missense probably benign
RF002:Lyst UTSW 13 13,808,948 (GRCm39) missense probably benign 0.05
X0024:Lyst UTSW 13 13,809,033 (GRCm39) missense probably benign 0.00
X0026:Lyst UTSW 13 13,926,555 (GRCm39) missense probably damaging 0.99
Z1088:Lyst UTSW 13 13,918,018 (GRCm39) missense probably benign 0.09
Z1176:Lyst UTSW 13 13,951,664 (GRCm39) missense probably benign 0.27
Z1176:Lyst UTSW 13 13,814,692 (GRCm39) missense probably damaging 1.00
Z1177:Lyst UTSW 13 13,854,719 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATTTGATACTATGGAGCAGGCC -3'
(R):5'- TAAACATACTTTGGGCTAGATACCGTC -3'

Sequencing Primer
(F):5'- ATACTATGGAGCAGGCCTTATTTG -3'
(R):5'- GGCTAGATACCGTCATGTTATACTGC -3'
Posted On 2015-09-25