Incidental Mutation 'R4622:Eva1c'
ID 346281
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission 041887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4622 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 90694343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099543] [ENSMUST00000099543] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231280] [ENSMUST00000231964] [ENSMUST00000231964]
AlphaFold P58659
Predicted Effect probably null
Transcript: ENSMUST00000037539
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037539
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099543
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099543
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099543
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099543
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099548
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099548
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231280
Predicted Effect probably null
Transcript: ENSMUST00000231280
Predicted Effect probably null
Transcript: ENSMUST00000231964
Predicted Effect probably null
Transcript: ENSMUST00000231964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (107/109)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,914,474 (GRCm39) N26Y probably damaging Het
Aass C T 6: 23,092,329 (GRCm39) D194N probably damaging Het
Acp7 T C 7: 28,313,822 (GRCm39) Y404C probably damaging Het
Acsl1 A T 8: 46,979,410 (GRCm39) I421L probably benign Het
Adgrb3 A T 1: 25,865,569 (GRCm39) D91E probably damaging Het
Adgrg3 T C 8: 95,767,153 (GRCm39) S503P probably damaging Het
Adgrg6 A T 10: 14,317,243 (GRCm39) C526S probably damaging Het
Arhgap32 A T 9: 32,150,644 (GRCm39) I15F possibly damaging Het
Arid1b G T 17: 5,045,325 (GRCm39) probably benign Het
Asnsd1 A G 1: 53,387,378 (GRCm39) V83A probably benign Het
Atg101 A G 15: 101,191,213 (GRCm39) probably benign Het
Atp8a1 T C 5: 67,840,056 (GRCm39) probably benign Het
Aurkb T A 11: 68,939,188 (GRCm39) L137Q probably damaging Het
AY702103 A T 17: 50,547,029 (GRCm39) noncoding transcript Het
B3gnt9 A G 8: 105,980,477 (GRCm39) S304P probably benign Het
Babam2 T C 5: 32,164,656 (GRCm39) V310A probably damaging Het
Batf A G 12: 85,755,327 (GRCm39) D60G possibly damaging Het
Baz1a A T 12: 54,988,300 (GRCm39) I283K probably benign Het
Bmerb1 A C 16: 13,911,786 (GRCm39) E44A possibly damaging Het
Bst1 T G 5: 43,976,261 (GRCm39) probably benign Het
C2 C A 17: 35,082,650 (GRCm39) V490L probably damaging Het
Cacna1e T C 1: 154,347,311 (GRCm39) E952G possibly damaging Het
Ccnyl1 A G 1: 64,757,417 (GRCm39) D262G probably damaging Het
Cdc42bpa A T 1: 179,902,223 (GRCm39) K493N probably damaging Het
Cenpe A G 3: 134,949,469 (GRCm39) T85A probably benign Het
Ces2e T A 8: 105,655,341 (GRCm39) probably null Het
Chd3 T A 11: 69,239,834 (GRCm39) R1665W probably damaging Het
Cpm A G 10: 117,506,202 (GRCm39) N188D possibly damaging Het
Cspg4b A G 13: 113,456,615 (GRCm39) D887G probably benign Het
Ctnnd2 A T 15: 30,887,315 (GRCm39) M781L probably benign Het
Ctnnd2 A G 15: 31,009,259 (GRCm39) T1094A probably benign Het
Cux1 T C 5: 136,337,154 (GRCm39) K657R probably damaging Het
Ddx54 G A 5: 120,764,488 (GRCm39) V732M probably damaging Het
Ecrg4 G T 1: 43,781,481 (GRCm39) R121L possibly damaging Het
Efna5 T C 17: 62,958,040 (GRCm39) D72G probably benign Het
Evi5l T C 8: 4,252,909 (GRCm39) probably benign Het
Fasl A G 1: 161,614,703 (GRCm39) L120P probably benign Het
H2-M9 A T 17: 36,952,716 (GRCm39) probably null Het
Hdgf C A 3: 87,821,884 (GRCm39) N198K possibly damaging Het
Hspa9 A T 18: 35,082,090 (GRCm39) M172K possibly damaging Het
Il1r1 A C 1: 40,351,580 (GRCm39) L406F probably damaging Het
Il31 T C 5: 123,618,498 (GRCm39) D96G probably damaging Het
Inhbc A G 10: 127,193,146 (GRCm39) I290T probably benign Het
Lrp2 A T 2: 69,290,693 (GRCm39) V3589D possibly damaging Het
Lrrc14 A T 15: 76,600,540 (GRCm39) probably benign Het
Lyst G A 13: 13,848,983 (GRCm39) A2057T probably benign Het
Macf1 A G 4: 123,266,141 (GRCm39) probably null Het
Mapk10 C A 5: 103,137,590 (GRCm39) G209V probably damaging Het
Mcoln1 A G 8: 3,555,923 (GRCm39) I73V probably damaging Het
Met G T 6: 17,513,383 (GRCm39) R411L probably benign Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrpl4 G A 9: 20,918,793 (GRCm39) R176Q probably damaging Het
Mrtfb G A 16: 13,150,570 (GRCm39) G102D probably damaging Het
Mtmr3 T C 11: 4,441,067 (GRCm39) T528A possibly damaging Het
Mtmr7 A T 8: 41,034,583 (GRCm39) N246K probably damaging Het
Mycbp2 G T 14: 103,457,415 (GRCm39) T1627K probably benign Het
Necab3 A G 2: 154,397,502 (GRCm39) probably null Het
Nr1d1 C T 11: 98,660,710 (GRCm39) C419Y probably damaging Het
Nwd1 C A 8: 73,393,928 (GRCm39) A397E probably damaging Het
Oas1f A T 5: 120,986,390 (GRCm39) K114N probably damaging Het
Or13a18 T A 7: 140,190,611 (GRCm39) C169* probably null Het
Or1e35 C A 11: 73,797,737 (GRCm39) V194F possibly damaging Het
Or51ab3 G T 7: 103,201,361 (GRCm39) R123L probably benign Het
Or5k8 A T 16: 58,644,469 (GRCm39) I201N possibly damaging Het
Or5w13 T A 2: 87,523,987 (GRCm39) K80* probably null Het
Osbpl8 T C 10: 111,127,357 (GRCm39) S814P probably benign Het
Pcdhgb7 A T 18: 37,886,183 (GRCm39) Q451L probably benign Het
Pde7b C T 10: 20,294,538 (GRCm39) R300Q probably damaging Het
Pgghg A G 7: 140,521,409 (GRCm39) probably null Het
Plcg1 A G 2: 160,589,688 (GRCm39) probably benign Het
Plxna2 A T 1: 194,494,458 (GRCm39) I1892L probably benign Het
Ppt2 A G 17: 34,844,875 (GRCm39) V123A probably benign Het
Prdx5 G T 19: 6,884,341 (GRCm39) probably benign Het
Prpf40b A G 15: 99,214,197 (GRCm39) D819G probably benign Het
Prss3l A T 6: 41,422,246 (GRCm39) I53N probably damaging Het
Psap T G 10: 60,136,630 (GRCm39) C536W probably damaging Het
Rab3gap1 T C 1: 127,870,156 (GRCm39) C919R probably benign Het
Racgap1 C A 15: 99,524,087 (GRCm39) S440I probably benign Het
Rec8 C T 14: 55,862,215 (GRCm39) R480C probably damaging Het
Reg3d A G 6: 78,354,442 (GRCm39) L53S probably benign Het
Rnft2 T A 5: 118,370,471 (GRCm39) S244C probably damaging Het
Scn2a T C 2: 65,582,371 (GRCm39) V1573A probably benign Het
Selenoo G T 15: 88,979,910 (GRCm39) G353* probably null Het
Siva1 A G 12: 112,611,501 (GRCm39) Y34C probably damaging Het
Slc2a4 C T 11: 69,835,600 (GRCm39) probably benign Het
Slc39a12 A T 2: 14,405,136 (GRCm39) T243S probably benign Het
Slc9b2 T C 3: 135,038,279 (GRCm39) I453T probably damaging Het
Spag17 A G 3: 100,010,559 (GRCm39) T2018A probably benign Het
Tbc1d24 A T 17: 24,427,865 (GRCm39) D32E probably benign Het
Tet1 T A 10: 62,655,253 (GRCm39) H1556L possibly damaging Het
Tmem59 A T 4: 107,047,915 (GRCm39) probably benign Het
Ttn A T 2: 76,731,296 (GRCm39) probably benign Het
Uimc1 A T 13: 55,225,307 (GRCm39) L89H probably damaging Het
Vipas39 A G 12: 87,291,317 (GRCm39) I343T probably damaging Het
Vmn2r71 G T 7: 85,269,817 (GRCm39) V443L probably benign Het
Zbtb14 G A 17: 69,695,342 (GRCm39) D347N possibly damaging Het
Zfp980 G T 4: 145,428,627 (GRCm39) C452F probably damaging Het
Zmym5 T A 14: 57,049,693 (GRCm39) probably benign Het
Znfx1 T C 2: 166,883,673 (GRCm39) T145A possibly damaging Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4760:Eva1c UTSW 16 90,701,138 (GRCm39) missense probably benign 0.37
R4767:Eva1c UTSW 16 90,701,235 (GRCm39) missense probably damaging 1.00
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R6605:Eva1c UTSW 16 90,663,236 (GRCm39) missense probably damaging 1.00
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8489:Eva1c UTSW 16 90,672,999 (GRCm39) missense probably damaging 1.00
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
R9270:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACTTTCTATTCCTATGGCAGGCC -3'
(R):5'- TGGAGACGAAACCCTCAGTC -3'

Sequencing Primer
(F):5'- CTATGGCAGGCCTGGGTG -3'
(R):5'- AGTCACTCAACTTCATTCTTGTAGG -3'
Posted On 2015-09-25