Mutagenetix > Incidental Mutations

Incidental Mutation 'R4622:Hspa9'

346289

Institutional Source

Beutler Lab

Gene Symbol

Hspa9

Ensembl Gene

ENSMUSG00000024359

Gene Name

heat shock protein 9

Synonyms

C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin

MMRRC Submission

041887-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R4622 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34937414-34954357 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34949037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 172 (M172K)

Ref Sequence

ENSEMBL: ENSMUSP00000025217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025217]

AlphaFold

P38647

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025217
AA Change: M172K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: M172K

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Pfam:HSP70	55	653	2.7e-270	PFAM
Pfam:FGGY_C	283	429	3e-8	PFAM
low complexity region	657	679	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173806

Meta Mutation Damage Score

0.0693

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

98% (107/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	G	T	1: 43,742,321	R121L	possibly damaging	Het
2900011O08Rik	A	C	16: 14,093,922	E44A	possibly damaging	Het
Aadacl2	A	T	3: 60,007,053	N26Y	probably damaging	Het
Aass	C	T	6: 23,092,330	D194N	probably damaging	Het
Acp7	T	C	7: 28,614,397	Y404C	probably damaging	Het
Acsl1	A	T	8: 46,526,373	I421L	probably benign	Het
Adgrb3	A	T	1: 25,826,488	D91E	probably damaging	Het
Adgrg3	T	C	8: 95,040,525	S503P	probably damaging	Het
Adgrg6	A	T	10: 14,441,499	C526S	probably damaging	Het
Arhgap32	A	T	9: 32,239,348	I15F	possibly damaging	Het
Arid1b	G	T	17: 4,995,050		probably benign	Het
Asnsd1	A	G	1: 53,348,219	V83A	probably benign	Het
Atg101	A	G	15: 101,293,332		probably benign	Het
Atp8a1	T	C	5: 67,682,713		probably benign	Het
Aurkb	T	A	11: 69,048,362	L137Q	probably damaging	Het
AY702103	A	T	17: 50,240,001		noncoding transcript	Het
B3gnt9	A	G	8: 105,253,845	S304P	probably benign	Het
Babam2	T	C	5: 32,007,312	V310A	probably damaging	Het
Batf	A	G	12: 85,708,553	D60G	possibly damaging	Het
Baz1a	A	T	12: 54,941,515	I283K	probably benign	Het
BC067074	A	G	13: 113,320,081	D887G	probably benign	Het
Bst1	T	G	5: 43,818,919		probably benign	Het
C2	C	A	17: 34,863,674	V490L	probably damaging	Het
Cacna1e	T	C	1: 154,471,565	E952G	possibly damaging	Het
Ccnyl1	A	G	1: 64,718,258	D262G	probably damaging	Het
Cdc42bpa	A	T	1: 180,074,658	K493N	probably damaging	Het
Cenpe	A	G	3: 135,243,708	T85A	probably benign	Het
Ces2e	T	A	8: 104,928,709		probably null	Het
Chd3	T	A	11: 69,349,008	R1665W	probably damaging	Het
Cpm	A	G	10: 117,670,297	N188D	possibly damaging	Het
Ctnnd2	A	T	15: 30,887,169	M781L	probably benign	Het
Ctnnd2	A	G	15: 31,009,113	T1094A	probably benign	Het
Cux1	T	C	5: 136,308,300	K657R	probably damaging	Het
Ddx54	G	A	5: 120,626,423	V732M	probably damaging	Het
Efna5	T	C	17: 62,651,045	D72G	probably benign	Het
Eva1c	T	A	16: 90,897,455		probably null	Het
Evi5l	T	C	8: 4,202,909		probably benign	Het
Fasl	A	G	1: 161,787,134	L120P	probably benign	Het
Gm10334	A	T	6: 41,445,312	I53N	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
H2-M9	A	T	17: 36,641,824		probably null	Het
Hdgf	C	A	3: 87,914,577	N198K	possibly damaging	Het
Il1r1	A	C	1: 40,312,420	L406F	probably damaging	Het
Il31	T	C	5: 123,480,435	D96G	probably damaging	Het
Inhbc	A	G	10: 127,357,277	I290T	probably benign	Het
Lrp2	A	T	2: 69,460,349	V3589D	possibly damaging	Het
Lrrc14	A	T	15: 76,716,340		probably benign	Het
Lyst	G	A	13: 13,674,398	A2057T	probably benign	Het
Macf1	A	G	4: 123,372,348		probably null	Het
Mapk10	C	A	5: 102,989,724	G209V	probably damaging	Het
Mcoln1	A	G	8: 3,505,923	I73V	probably damaging	Het
Met	G	T	6: 17,513,384	R411L	probably benign	Het
Mkl2	G	A	16: 13,332,706	G102D	probably damaging	Het
Mrpl4	G	A	9: 21,007,497	R176Q	probably damaging	Het
Mtmr3	T	C	11: 4,491,067	T528A	possibly damaging	Het
Mtmr7	A	T	8: 40,581,541	N246K	probably damaging	Het
Mycbp2	G	T	14: 103,219,979	T1627K	probably benign	Het
Necab3	A	G	2: 154,555,582		probably null	Het
Nr1d1	C	T	11: 98,769,884	C419Y	probably damaging	Het
Nwd1	C	A	8: 72,667,300	A397E	probably damaging	Het
Oas1f	A	T	5: 120,848,327	K114N	probably damaging	Het
Olfr1136	T	A	2: 87,693,643	K80*	probably null	Het
Olfr175-ps1	A	T	16: 58,824,106	I201N	possibly damaging	Het
Olfr395	C	A	11: 73,906,911	V194F	possibly damaging	Het
Olfr46	T	A	7: 140,610,698	C169*	probably null	Het
Olfr613	G	T	7: 103,552,154	R123L	probably benign	Het
Osbpl8	T	C	10: 111,291,496	S814P	probably benign	Het
Pcdhgb7	A	T	18: 37,753,130	Q451L	probably benign	Het
Pde7b	C	T	10: 20,418,792	R300Q	probably damaging	Het
Pgghg	A	G	7: 140,941,496		probably null	Het
Plcg1	A	G	2: 160,747,768		probably benign	Het
Plxna2	A	T	1: 194,812,150	I1892L	probably benign	Het
Ppt2	A	G	17: 34,625,901	V123A	probably benign	Het
Prdx5	G	T	19: 6,906,973		probably benign	Het
Prpf40b	A	G	15: 99,316,316	D819G	probably benign	Het
Psap	T	G	10: 60,300,851	C536W	probably damaging	Het
Rab3gap1	T	C	1: 127,942,419	C919R	probably benign	Het
Racgap1	C	A	15: 99,626,206	S440I	probably benign	Het
Rec8	C	T	14: 55,624,758	R480C	probably damaging	Het
Reg3d	A	G	6: 78,377,459	L53S	probably benign	Het
Rnft2	T	A	5: 118,232,406	S244C	probably damaging	Het
Scn2a	T	C	2: 65,752,027	V1573A	probably benign	Het
Selenoo	G	T	15: 89,095,707	G353*	probably null	Het
Siva1	A	G	12: 112,645,067	Y34C	probably damaging	Het
Slc2a4	C	T	11: 69,944,774		probably benign	Het
Slc39a12	A	T	2: 14,400,325	T243S	probably benign	Het
Slc9b2	T	C	3: 135,332,518	I453T	probably damaging	Het
Spag17	A	G	3: 100,103,243	T2018A	probably benign	Het
Tbc1d24	A	T	17: 24,208,891	D32E	probably benign	Het
Tet1	T	A	10: 62,819,474	H1556L	possibly damaging	Het
Tmem59	A	T	4: 107,190,718		probably benign	Het
Ttn	A	T	2: 76,900,952		probably benign	Het
Uimc1	A	T	13: 55,077,494	L89H	probably damaging	Het
Vipas39	A	G	12: 87,244,543	I343T	probably damaging	Het
Vmn2r71	G	T	7: 85,620,609	V443L	probably benign	Het
Zbtb14	G	A	17: 69,388,347	D347N	possibly damaging	Het
Zfp980	G	T	4: 145,702,057	C452F	probably damaging	Het
Zmym5	T	A	14: 56,812,236		probably benign	Het
Znfx1	T	C	2: 167,041,753	T145A	possibly damaging	Het

Other mutations in Hspa9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Hspa9	APN	18	34938580	splice site	probably benign
IGL01939:Hspa9	APN	18	34938708	missense	possibly damaging	0.89
IGL02008:Hspa9	APN	18	34947975	nonsense	probably null
IGL02604:Hspa9	APN	18	34954213	missense	unknown
Chiri-san	UTSW	18	34939423	missense	probably damaging	1.00
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0278:Hspa9	UTSW	18	34940910	missense	possibly damaging	0.50
R0613:Hspa9	UTSW	18	34947980	missense	probably damaging	1.00
R1414:Hspa9	UTSW	18	34938591	missense	probably damaging	1.00
R1454:Hspa9	UTSW	18	34938606	missense	probably damaging	1.00
R2013:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2014:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2015:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2936:Hspa9	UTSW	18	34948014	missense	probably damaging	1.00
R4261:Hspa9	UTSW	18	34939423	missense	probably damaging	1.00
R4819:Hspa9	UTSW	18	34939388	missense	probably damaging	0.98
R5056:Hspa9	UTSW	18	34938681	missense	probably damaging	1.00
R5223:Hspa9	UTSW	18	34952671	splice site	probably null
R5666:Hspa9	UTSW	18	34954247	missense	probably null
R5820:Hspa9	UTSW	18	34943174	missense	possibly damaging	0.82
R5944:Hspa9	UTSW	18	34949023	missense	possibly damaging	0.94
R6460:Hspa9	UTSW	18	34952712	missense	probably benign
R7404:Hspa9	UTSW	18	34943276	missense	possibly damaging	0.76
R7412:Hspa9	UTSW	18	34949029	missense	probably damaging	1.00
R7637:Hspa9	UTSW	18	34938687	missense	not run
R8524:Hspa9	UTSW	18	34954244	missense	unknown
R8830:Hspa9	UTSW	18	34948104	critical splice donor site	probably null
R8987:Hspa9	UTSW	18	34947929	missense	probably damaging	1.00
R9028:Hspa9	UTSW	18	34942031	missense	probably damaging	1.00
R9184:Hspa9	UTSW	18	34949115	missense	possibly damaging	0.87
Z1177:Hspa9	UTSW	18	34943145	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AACCCAATCTGCAGGTTCTAC -3'
(R):5'- AAGTCAGTGTTCAACTTCTTCCTTG -3'

Sequencing Primer
(F):5'- AATCTGCAGGTTCTACCCTTC -3'
(R):5'- TGGACATTTTCTTAGAGACTATCTGG -3'

Posted On

2015-09-25