Mutagenetix > Incidental Mutation

Incidental Mutation 'R0255:Anapc1'

34632

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

038486-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0255 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128634711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1329 (M1329K)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

probably damaging
Transcript: ENSMUST00000014499
AA Change: M1329K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: M1329K

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154320

Meta Mutation Damage Score

0.4220

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.6%

Validation Efficiency

93% (102/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,226,045	F119S	probably damaging	Het
1810011H11Rik	A	G	14: 32,808,363	K83E	possibly damaging	Het
Abca13	C	A	11: 9,581,545	Q4591K	probably damaging	Het
Aoah	A	T	13: 20,979,540	K338*	probably null	Het
Ascc3	A	T	10: 50,645,058	T416S	probably benign	Het
Baz2a	A	G	10: 128,114,639	T484A	possibly damaging	Het
Btnl6	T	C	17: 34,508,503	N351S	probably benign	Het
Cacna1s	T	G	1: 136,118,806	I1772S	possibly damaging	Het
Ccdc8	A	G	7: 16,995,657	D357G	unknown	Het
Ccna1	T	C	3: 55,050,628	E152G	probably damaging	Het
Cct4	A	G	11: 22,999,073	D273G	probably damaging	Het
Cd9	A	G	6: 125,463,740	V96A	probably damaging	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cdh7	T	C	1: 109,994,306	S43P	probably benign	Het
Cep95	G	A	11: 106,811,271	V365M	probably benign	Het
Ces1c	T	C	8: 93,127,524	T128A	probably benign	Het
Chil5	A	G	3: 106,019,267	V82A	probably damaging	Het
Clmn	T	C	12: 104,781,764	D508G	probably benign	Het
Cog8	A	T	8: 107,049,145		probably benign	Het
Cst3	A	T	2: 148,875,169	V70E	probably damaging	Het
Ctcf	A	G	8: 105,664,039	T93A	possibly damaging	Het
Ctsk	C	A	3: 95,508,877	N315K	probably benign	Het
Cyp2j12	G	T	4: 96,141,025	D6E	probably benign	Het
Dhx34	A	G	7: 16,205,992	V655A	probably benign	Het
Dock10	T	C	1: 80,605,876	Y203C	probably damaging	Het
Dok7	A	T	5: 35,064,334	D26V	probably damaging	Het
Epha8	G	A	4: 136,940,286	H295Y	probably damaging	Het
Esf1	A	G	2: 140,148,923		probably benign	Het
Fam83c	A	G	2: 155,829,752	S588P	probably benign	Het
Fat3	G	A	9: 15,969,706		probably benign	Het
Fhdc1	T	C	3: 84,453,510		probably benign	Het
Frmd4b	A	G	6: 97,308,086	V338A	probably damaging	Het
Fsd1l	A	G	4: 53,694,727	T394A	probably damaging	Het
Gbf1	A	G	19: 46,254,110		probably benign	Het
Glg1	G	T	8: 111,159,858	Q1101K	possibly damaging	Het
Glt8d2	T	A	10: 82,651,527		probably null	Het
Gm19345	T	C	7: 19,854,930		probably benign	Het
Gpr179	A	T	11: 97,336,066	D1754E	probably benign	Het
Hydin	A	G	8: 110,565,018	T3381A	probably benign	Het
Igkv12-41	G	A	6: 69,858,838	T16I	possibly damaging	Het
Insl5	A	G	4: 103,018,116	*146Q	probably null	Het
Iqce	A	T	5: 140,666,202	I655N	possibly damaging	Het
Irf2bp1	G	A	7: 19,005,002	R189H	possibly damaging	Het
Itsn1	C	T	16: 91,806,090		probably benign	Het
Kansl3	A	T	1: 36,344,969	I724N	probably benign	Het
Kcna4	T	C	2: 107,296,562	I547T	probably damaging	Het
Klk1b4	A	T	7: 44,210,734	I91F	probably benign	Het
Lmbr1	A	G	5: 29,252,755	S282P	probably damaging	Het
Lrrc17	G	A	5: 21,560,969	A150T	probably benign	Het
Lrrc2	A	G	9: 110,980,898	E334G	possibly damaging	Het
Lrrc7	G	A	3: 158,160,838	Q1077*	probably null	Het
Mapk8	A	T	14: 33,387,307		probably benign	Het
Mast1	T	A	8: 84,912,021	T1560S	probably benign	Het
Mdh1b	C	A	1: 63,719,618	A272S	probably damaging	Het
Myo15b	T	C	11: 115,886,283	Y912H	probably damaging	Het
Nf1	T	G	11: 79,408,699		probably null	Het
Nme7	T	A	1: 164,345,375	D218E	probably damaging	Het
Nsun7	T	A	5: 66,289,408		probably benign	Het
Nxpe2	A	G	9: 48,340,570		probably null	Het
Olfr135	T	G	17: 38,208,395	I50R	probably benign	Het
Olfr394	A	G	11: 73,887,829	V181A	probably benign	Het
Olfr473	T	A	7: 107,934,168	V216D	probably damaging	Het
Olfr698	G	A	7: 106,752,989	T133I	probably benign	Het
P2ry1	T	C	3: 61,003,530	V30A	probably benign	Het
Pgm1	T	A	5: 64,112,043	I491N	possibly damaging	Het
Pkd1l3	A	T	8: 109,638,754	D1169V	probably damaging	Het
Poldip2	T	A	11: 78,512,363	S18T	probably benign	Het
Ppp1r32	C	T	19: 10,475,054	R364Q	probably damaging	Het
Pqlc1	C	T	18: 80,263,518	A101V	probably benign	Het
Prg4	C	T	1: 150,455,807		probably benign	Het
Prkab2	T	A	3: 97,667,412	Y241*	probably null	Het
Prmt7	A	G	8: 106,227,207		probably benign	Het
Proser3	T	A	7: 30,546,417	R80W	probably damaging	Het
Prr12	A	G	7: 45,049,991		probably benign	Het
Psmd1	A	T	1: 86,078,582	L223F	probably damaging	Het
Rab13	A	G	3: 90,223,781		probably benign	Het
Rgl1	C	T	1: 152,552,596	C294Y	probably damaging	Het
Rpl21-ps4	C	A	14: 11,227,556		noncoding transcript	Het
Rusc2	T	C	4: 43,423,954	V1036A	probably damaging	Het
Sae1	T	A	7: 16,370,322	K121*	probably null	Het
Sap130	C	T	18: 31,680,506	P539S	probably damaging	Het
Scube2	A	G	7: 109,824,872	L475P	probably damaging	Het
Sec16a	T	C	2: 26,431,186	D1298G	probably damaging	Het
Serpinb9b	T	C	13: 33,038,020	F206L	probably benign	Het
Sh3bp1	T	A	15: 78,904,334	Y202*	probably null	Het
Shprh	T	A	10: 11,186,391	C1177S	possibly damaging	Het
Slc27a6	T	C	18: 58,609,865	Y542H	possibly damaging	Het
Slc41a1	T	C	1: 131,843,912		probably benign	Het
Slc46a1	T	C	11: 78,470,799	F424L	probably damaging	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc6a20a	A	G	9: 123,664,621	V65A	probably damaging	Het
Slc9c1	T	A	16: 45,554,300	S343T	probably benign	Het
Spcs3	C	A	8: 54,528,380	R60I	probably benign	Het
Ssfa2	T	A	2: 79,660,466	L976Q	probably damaging	Het
Tbc1d16	C	A	11: 119,147,575	R764L	possibly damaging	Het
Tcaf2	A	T	6: 42,642,904	V63E	possibly damaging	Het
Tmc1	G	T	19: 20,789,587	A750E	possibly damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tmx3	T	C	18: 90,540,006	I394T	probably damaging	Het
Trank1	G	A	9: 111,366,024	E1039K	possibly damaging	Het
Trpc4ap	A	G	2: 155,657,946		probably benign	Het
Tsen54	T	C	11: 115,815,408	C123R	probably damaging	Het
Ubtd1	A	G	19: 42,031,934	D39G	possibly damaging	Het
Vmn1r181	A	T	7: 23,984,334	M75L	probably benign	Het
Zc3h7a	T	C	16: 11,140,737	T847A	probably damaging	Het
Zc3hav1	A	G	6: 38,336,550	C187R	probably damaging	Het
Zfp692	G	A	11: 58,310,403		probably benign	Het
Zmiz1	G	A	14: 25,654,495		probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGTAGATCATAGCCAACGCCAGAGTAG -3'
(R):5'- GGACAAATAGGGCTTCTGAGTTGAGTG -3'

Sequencing Primer
(F):5'- GGACAAGTCACATCCACGTTTATG -3'
(R):5'- CTGGTGCAGTAATGAAAGTACTC -3'

Posted On

2013-05-09