Incidental Mutation 'R4623:Slc6a13'
ID 346324
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission 041888-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R4623 (G1)
Quality Score 214
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121302104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: S229P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: S229P

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142021
Predicted Effect probably benign
Transcript: ENSMUST00000142419
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Meta Mutation Damage Score 0.9465 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik T C 12: 11,272,141 (GRCm39) noncoding transcript Het
A930003A15Rik C T 16: 19,702,487 (GRCm39) noncoding transcript Het
Abca13 A G 11: 9,259,130 (GRCm39) Y2952C probably damaging Het
Actrt2 T C 4: 154,751,747 (GRCm39) T130A probably benign Het
Adamts7 T A 9: 90,068,515 (GRCm39) D475E probably benign Het
Adgrf5 A G 17: 43,761,874 (GRCm39) S1190G probably benign Het
Adgrg6 A T 10: 14,317,243 (GRCm39) C526S probably damaging Het
Aldoc T C 11: 78,215,947 (GRCm39) V151A probably damaging Het
Arsj A T 3: 126,158,445 (GRCm39) E8V probably benign Het
Asph T C 4: 9,622,005 (GRCm39) K167E possibly damaging Het
Auts2 G A 5: 131,469,221 (GRCm39) P475S probably benign Het
C1d A G 11: 17,212,742 (GRCm39) D29G possibly damaging Het
Calb1 T A 4: 15,895,721 (GRCm39) probably benign Het
Ceacam15 A T 7: 16,407,391 (GRCm39) F42Y probably damaging Het
Cpm A G 10: 117,506,202 (GRCm39) N188D possibly damaging Het
Cts6 A T 13: 61,349,974 (GRCm39) Y36N possibly damaging Het
Cux1 T C 5: 136,337,154 (GRCm39) K657R probably damaging Het
Cyp2a22 G T 7: 26,632,916 (GRCm39) P429T probably damaging Het
Dipk2a T C 9: 94,402,451 (GRCm39) N404D possibly damaging Het
Dock3 T C 9: 106,939,244 (GRCm39) E168G possibly damaging Het
Dot1l A G 10: 80,617,984 (GRCm39) N324S probably benign Het
Dusp13b A C 14: 21,793,546 (GRCm39) probably benign Het
Eif4g1 T A 16: 20,500,095 (GRCm39) probably benign Het
Fan1 G T 7: 64,023,301 (GRCm39) Y121* probably null Het
Foxn4 T C 5: 114,398,991 (GRCm39) E80G possibly damaging Het
Gal3st2c C A 1: 93,937,178 (GRCm39) H374Q possibly damaging Het
Gm973 A T 1: 59,595,435 (GRCm39) I409F probably damaging Het
Gpr18 T A 14: 122,149,579 (GRCm39) T149S probably damaging Het
Gsr A G 8: 34,170,333 (GRCm39) E206G probably damaging Het
Hal A G 10: 93,343,301 (GRCm39) H515R probably damaging Het
Heatr5b A G 17: 79,102,548 (GRCm39) S1277P possibly damaging Het
Hmcn2 A G 2: 31,286,722 (GRCm39) E2125G probably damaging Het
Ikzf4 A G 10: 128,476,988 (GRCm39) C108R probably damaging Het
Kcnh2 A G 5: 24,553,440 (GRCm39) V59A probably benign Het
Khdrbs1 A G 4: 129,614,635 (GRCm39) V306A probably benign Het
Kif11 A T 19: 37,398,195 (GRCm39) I674L probably benign Het
Lrp1b A T 2: 41,136,033 (GRCm39) C1646S probably damaging Het
Ltbp2 A G 12: 84,856,122 (GRCm39) I707T probably damaging Het
Macf1 A G 4: 123,266,141 (GRCm39) probably null Het
Mib1 C A 18: 10,808,086 (GRCm39) N944K probably benign Het
Mical3 C A 6: 120,938,586 (GRCm39) E262* probably null Het
Mms22l C T 4: 24,502,792 (GRCm39) Q55* probably null Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrps11 T C 7: 78,441,689 (GRCm39) probably null Het
Myh8 A G 11: 67,177,084 (GRCm39) E412G probably damaging Het
Myo9a T A 9: 59,778,355 (GRCm39) D1370E probably benign Het
Ncapd2 A G 6: 125,150,572 (GRCm39) V843A probably benign Het
Nell1 A G 7: 49,770,310 (GRCm39) E123G possibly damaging Het
Nkd1 A G 8: 89,316,383 (GRCm39) D213G probably benign Het
Nlrp1b T C 11: 71,052,669 (GRCm39) T920A probably benign Het
Or5k8 A T 16: 58,644,469 (GRCm39) I201N possibly damaging Het
Or6c208 G A 10: 129,223,915 (GRCm39) V138M probably benign Het
Or8k40 T A 2: 86,584,906 (GRCm39) M59L possibly damaging Het
Pde8b C T 13: 95,178,447 (GRCm39) A566T possibly damaging Het
Pds5b T A 5: 150,724,066 (GRCm39) S1214R probably benign Het
Pld1 T C 3: 28,083,393 (GRCm39) I171T probably benign Het
Plekha5 T A 6: 140,496,912 (GRCm39) V154E probably damaging Het
Plxna2 A T 1: 194,494,458 (GRCm39) I1892L probably benign Het
Ppp1r16b A G 2: 158,603,383 (GRCm39) Y436C possibly damaging Het
Proc T A 18: 32,260,526 (GRCm39) T200S probably benign Het
Psap T G 10: 60,136,630 (GRCm39) C536W probably damaging Het
Ptger2 G A 14: 45,226,471 (GRCm39) R17H possibly damaging Het
Rab42 A G 4: 132,030,504 (GRCm39) F49L possibly damaging Het
Racgap1 C A 15: 99,524,087 (GRCm39) S440I probably benign Het
Rdh10 G A 1: 16,201,287 (GRCm39) probably benign Het
Rnft2 T A 5: 118,370,471 (GRCm39) S244C probably damaging Het
Sftpc T C 14: 70,759,718 (GRCm39) probably null Het
Shcbp1 A C 8: 4,789,178 (GRCm39) V547G probably damaging Het
Soat2 A T 15: 102,066,144 (GRCm39) probably benign Het
Swap70 A G 7: 109,867,079 (GRCm39) K294E probably benign Het
Tcim C A 8: 24,928,725 (GRCm39) R63L probably damaging Het
Tek G A 4: 94,751,898 (GRCm39) V1013I probably damaging Het
Tg T A 15: 66,607,120 (GRCm39) M219K probably benign Het
Tie1 A G 4: 118,343,808 (GRCm39) S45P possibly damaging Het
Tmem59 A T 4: 107,047,915 (GRCm39) probably benign Het
Togaram1 A T 12: 65,029,224 (GRCm39) E882D possibly damaging Het
Tram1l1 T A 3: 124,115,509 (GRCm39) M223K possibly damaging Het
Tssk5 C T 15: 76,256,668 (GRCm39) R280Q probably benign Het
Uspl1 T A 5: 149,151,405 (GRCm39) D669E probably damaging Het
Vav1 C A 17: 57,606,839 (GRCm39) probably null Het
Vcl A T 14: 21,065,007 (GRCm39) E634V probably benign Het
Zfp672 A T 11: 58,207,281 (GRCm39) C347S probably benign Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACGTTCATAGCCCTGGGTTC -3'
(R):5'- CAGGTGTACATGGATGGAGC -3'

Sequencing Primer
(F):5'- TCCAACAACACAGAAAAGAGGG -3'
(R):5'- TACATGGATGGAGCCCCTGAG -3'
Posted On 2015-09-25