Incidental Mutation 'R4623:Dock3'
ID346339
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107062045 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 168 (E168G)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044532
AA Change: E168G

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: E168G

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167053
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7423:Dock3 UTSW 9 106967171 missense probably damaging 0.98
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGAAAGTGTGACATCAGAGTAC -3'
(R):5'- CATATCTTTTCTGGGGCAGTGC -3'

Sequencing Primer
(F):5'- GTGTGACATCAGAGTACTTCTAAGAG -3'
(R):5'- TGCCCAGAGCTCTGTCTACAG -3'
Posted On2015-09-25