Incidental Mutation 'R4623:Psap'
ID346341
Institutional Source Beutler Lab
Gene Symbol Psap
Ensembl Gene ENSMUSG00000004207
Gene Nameprosaposin
SynonymsSGP-1
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60277627-60302597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60300851 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 536 (C536W)
Ref Sequence ENSEMBL: ENSMUSP00000137476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]
Predicted Effect probably damaging
Transcript: ENSMUST00000004316
AA Change: C535W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: C535W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073242
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105464
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105465
AA Change: C533W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: C533W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156501
Predicted Effect probably damaging
Transcript: ENSMUST00000165878
AA Change: C530W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: C530W

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177779
AA Change: C536W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: C536W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179238
AA Change: C536W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: C536W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Psap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60292536 missense probably damaging 1.00
IGL01100:Psap APN 10 60299929 missense probably benign 0.03
IGL01122:Psap APN 10 60299474 missense probably benign 0.04
IGL02544:Psap APN 10 60300626 splice site probably benign
twerk UTSW 10 60300851 missense probably damaging 1.00
R0591:Psap UTSW 10 60300855 missense possibly damaging 0.65
R0624:Psap UTSW 10 60299566 splice site probably benign
R1018:Psap UTSW 10 60300811 missense probably damaging 1.00
R1896:Psap UTSW 10 60295046 nonsense probably null
R3161:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3615:Psap UTSW 10 60294603 missense probably benign 0.06
R3616:Psap UTSW 10 60294603 missense probably benign 0.06
R4622:Psap UTSW 10 60300851 missense probably damaging 1.00
R4666:Psap UTSW 10 60300545 missense probably benign
R5131:Psap UTSW 10 60299957 missense possibly damaging 0.72
R5203:Psap UTSW 10 60294975 missense probably damaging 1.00
R5251:Psap UTSW 10 60301700 missense probably damaging 0.99
R5511:Psap UTSW 10 60299180 missense possibly damaging 0.51
R5764:Psap UTSW 10 60293406 missense probably benign 0.18
R6207:Psap UTSW 10 60300538 missense probably damaging 1.00
R7003:Psap UTSW 10 60299497 missense probably damaging 1.00
R7494:Psap UTSW 10 60299496 missense probably benign 0.00
R7525:Psap UTSW 10 60299474 missense probably benign 0.04
R7711:Psap UTSW 10 60299855 missense probably damaging 0.96
X0019:Psap UTSW 10 60299915 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACAGCCAGACCTCTGTCAG -3'
(R):5'- AGGTTTGGTGCAATCCCTG -3'

Sequencing Primer
(F):5'- CTCTGTCAGGGGCTGGAAG -3'
(R):5'- CTGTGCATGAAGCTGGTAAGAC -3'
Posted On2015-09-25