Incidental Mutation 'R4623:Ikzf4'
ID346345
Institutional Source Beutler Lab
Gene Symbol Ikzf4
Ensembl Gene ENSMUSG00000002578
Gene NameIKAROS family zinc finger 4
SynonymsEos, Zfpn1a4, A630026H08Rik
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128630843-128645991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128641119 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 108 (C108R)
Ref Sequence ENSEMBL: ENSMUSP00000152234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133342] [ENSMUST00000221150] [ENSMUST00000222067] [ENSMUST00000223162]
Predicted Effect probably damaging
Transcript: ENSMUST00000065334
AA Change: C161R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066991
Gene: ENSMUSG00000002578
AA Change: C161R

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000113478
Gene: ENSMUSG00000002578
AA Change: C108R

DomainStartEndE-ValueType
ZnF_C2H2 106 128 7.67e-2 SMART
ZnF_C2H2 134 156 1.72e-4 SMART
ZnF_C2H2 162 184 1.72e-4 SMART
ZnF_C2H2 195 218 1.18e-2 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 3.52e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133342
AA Change: C161R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114404
Gene: ENSMUSG00000002578
AA Change: C161R

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
ZnF_C2H2 559 583 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221022
Predicted Effect probably damaging
Transcript: ENSMUST00000221150
AA Change: C161R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222067
AA Change: C108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222899
Predicted Effect probably benign
Transcript: ENSMUST00000222901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223145
Predicted Effect probably benign
Transcript: ENSMUST00000223162
Meta Mutation Damage Score 0.9734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Eos, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Ikzf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ikzf4 APN 10 128634547 missense probably benign 0.00
IGL01649:Ikzf4 APN 10 128635820 missense probably damaging 1.00
IGL02261:Ikzf4 APN 10 128636722 missense possibly damaging 0.50
IGL02315:Ikzf4 APN 10 128634145 missense probably damaging 1.00
R0099:Ikzf4 UTSW 10 128634197 missense probably damaging 0.97
R0200:Ikzf4 UTSW 10 128634676 missense probably damaging 0.96
R0365:Ikzf4 UTSW 10 128634407 missense probably benign
R0376:Ikzf4 UTSW 10 128632756 missense probably benign
R0456:Ikzf4 UTSW 10 128635808 missense probably damaging 0.98
R0536:Ikzf4 UTSW 10 128641249 missense probably benign 0.09
R1731:Ikzf4 UTSW 10 128634532 missense probably benign 0.03
R2017:Ikzf4 UTSW 10 128634157 missense probably damaging 1.00
R4158:Ikzf4 UTSW 10 128643736 intron probably benign
R4160:Ikzf4 UTSW 10 128643736 intron probably benign
R4789:Ikzf4 UTSW 10 128632706 missense probably benign 0.00
R5008:Ikzf4 UTSW 10 128641250 missense probably benign 0.03
R5432:Ikzf4 UTSW 10 128634178 missense probably damaging 1.00
R6091:Ikzf4 UTSW 10 128634673 missense probably benign 0.15
R6445:Ikzf4 UTSW 10 128636555 intron probably null
R7204:Ikzf4 UTSW 10 128643890 missense possibly damaging 0.64
R7219:Ikzf4 UTSW 10 128634383 missense possibly damaging 0.64
R7239:Ikzf4 UTSW 10 128641244 missense probably damaging 1.00
R7485:Ikzf4 UTSW 10 128632582 missense unknown
R7710:Ikzf4 UTSW 10 128632741 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGAAACATGCTCTGATTGACCC -3'
(R):5'- TGTACAGCGATGAGGAGTCG -3'

Sequencing Primer
(F):5'- GATTGACCCTTCCATTGCTGAAC -3'
(R):5'- CAGCGATGAGGAGTCGAGCAG -3'
Posted On2015-09-25