Incidental Mutation 'R4623:Olfr784'
ID346346
Institutional Source Beutler Lab
Gene Symbol Olfr784
Ensembl Gene ENSMUSG00000094347
Gene Nameolfactory receptor 784
SynonymsGA_x6K02T2PULF-11068246-11069205, MOR110-3
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129384083-129390198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129388046 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 138 (V138M)
Ref Sequence ENSEMBL: ENSMUSP00000149354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082342] [ENSMUST00000214064]
Predicted Effect probably benign
Transcript: ENSMUST00000082342
AA Change: V138M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080953
Gene: ENSMUSG00000094347
AA Change: V138M

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.3e-51 PFAM
Pfam:7tm_1 39 288 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214064
AA Change: V138M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Olfr784
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Olfr784 APN 10 129388104 missense probably benign 0.03
IGL03096:Olfr784 APN 10 129388449 missense probably damaging 0.96
IGL03365:Olfr784 APN 10 129388239 missense possibly damaging 0.94
R0645:Olfr784 UTSW 10 129388293 missense possibly damaging 0.88
R1104:Olfr784 UTSW 10 129388221 missense probably benign 0.31
R1456:Olfr784 UTSW 10 129387783 missense probably damaging 0.98
R1487:Olfr784 UTSW 10 129388340 missense probably benign 0.26
R1526:Olfr784 UTSW 10 129388307 missense probably benign 0.01
R1860:Olfr784 UTSW 10 129388086 missense probably damaging 1.00
R1930:Olfr784 UTSW 10 129387876 missense probably benign
R1931:Olfr784 UTSW 10 129387876 missense probably benign
R5385:Olfr784 UTSW 10 129387764 missense probably benign 0.05
R5483:Olfr784 UTSW 10 129387657 missense probably benign 0.02
R5780:Olfr784 UTSW 10 129388070 missense probably damaging 1.00
R6448:Olfr784 UTSW 10 129388152 missense probably damaging 1.00
R6956:Olfr784 UTSW 10 129388297 missense probably benign 0.04
R7102:Olfr784 UTSW 10 129388167 missense probably damaging 0.99
R7584:Olfr784 UTSW 10 129388032 missense probably damaging 0.99
R7626:Olfr784 UTSW 10 129387857 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACAACTGCCTGTATTCCACGG -3'
(R):5'- TGTCATGACAGCTAAGGCG -3'

Sequencing Primer
(F):5'- GCCTGTATTCCACGGTTCTTAATGAG -3'
(R):5'- GAAAGCCATCAATTCTATGAAACGTG -3'
Posted On2015-09-25