Incidental Mutation 'R4623:Abca13'
ID 346347
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A member 13
Synonyms A930002G16Rik
MMRRC Submission 041888-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4623 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 9141942-9634259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9259130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2952 (Y2952C)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042740
AA Change: Y2952C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: Y2952C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik T C 12: 11,272,141 (GRCm39) noncoding transcript Het
A930003A15Rik C T 16: 19,702,487 (GRCm39) noncoding transcript Het
Actrt2 T C 4: 154,751,747 (GRCm39) T130A probably benign Het
Adamts7 T A 9: 90,068,515 (GRCm39) D475E probably benign Het
Adgrf5 A G 17: 43,761,874 (GRCm39) S1190G probably benign Het
Adgrg6 A T 10: 14,317,243 (GRCm39) C526S probably damaging Het
Aldoc T C 11: 78,215,947 (GRCm39) V151A probably damaging Het
Arsj A T 3: 126,158,445 (GRCm39) E8V probably benign Het
Asph T C 4: 9,622,005 (GRCm39) K167E possibly damaging Het
Auts2 G A 5: 131,469,221 (GRCm39) P475S probably benign Het
C1d A G 11: 17,212,742 (GRCm39) D29G possibly damaging Het
Calb1 T A 4: 15,895,721 (GRCm39) probably benign Het
Ceacam15 A T 7: 16,407,391 (GRCm39) F42Y probably damaging Het
Cpm A G 10: 117,506,202 (GRCm39) N188D possibly damaging Het
Cts6 A T 13: 61,349,974 (GRCm39) Y36N possibly damaging Het
Cux1 T C 5: 136,337,154 (GRCm39) K657R probably damaging Het
Cyp2a22 G T 7: 26,632,916 (GRCm39) P429T probably damaging Het
Dipk2a T C 9: 94,402,451 (GRCm39) N404D possibly damaging Het
Dock3 T C 9: 106,939,244 (GRCm39) E168G possibly damaging Het
Dot1l A G 10: 80,617,984 (GRCm39) N324S probably benign Het
Dusp13b A C 14: 21,793,546 (GRCm39) probably benign Het
Eif4g1 T A 16: 20,500,095 (GRCm39) probably benign Het
Fan1 G T 7: 64,023,301 (GRCm39) Y121* probably null Het
Foxn4 T C 5: 114,398,991 (GRCm39) E80G possibly damaging Het
Gal3st2c C A 1: 93,937,178 (GRCm39) H374Q possibly damaging Het
Gm973 A T 1: 59,595,435 (GRCm39) I409F probably damaging Het
Gpr18 T A 14: 122,149,579 (GRCm39) T149S probably damaging Het
Gsr A G 8: 34,170,333 (GRCm39) E206G probably damaging Het
Hal A G 10: 93,343,301 (GRCm39) H515R probably damaging Het
Heatr5b A G 17: 79,102,548 (GRCm39) S1277P possibly damaging Het
Hmcn2 A G 2: 31,286,722 (GRCm39) E2125G probably damaging Het
Ikzf4 A G 10: 128,476,988 (GRCm39) C108R probably damaging Het
Kcnh2 A G 5: 24,553,440 (GRCm39) V59A probably benign Het
Khdrbs1 A G 4: 129,614,635 (GRCm39) V306A probably benign Het
Kif11 A T 19: 37,398,195 (GRCm39) I674L probably benign Het
Lrp1b A T 2: 41,136,033 (GRCm39) C1646S probably damaging Het
Ltbp2 A G 12: 84,856,122 (GRCm39) I707T probably damaging Het
Macf1 A G 4: 123,266,141 (GRCm39) probably null Het
Mib1 C A 18: 10,808,086 (GRCm39) N944K probably benign Het
Mical3 C A 6: 120,938,586 (GRCm39) E262* probably null Het
Mms22l C T 4: 24,502,792 (GRCm39) Q55* probably null Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Mrps11 T C 7: 78,441,689 (GRCm39) probably null Het
Myh8 A G 11: 67,177,084 (GRCm39) E412G probably damaging Het
Myo9a T A 9: 59,778,355 (GRCm39) D1370E probably benign Het
Ncapd2 A G 6: 125,150,572 (GRCm39) V843A probably benign Het
Nell1 A G 7: 49,770,310 (GRCm39) E123G possibly damaging Het
Nkd1 A G 8: 89,316,383 (GRCm39) D213G probably benign Het
Nlrp1b T C 11: 71,052,669 (GRCm39) T920A probably benign Het
Or5k8 A T 16: 58,644,469 (GRCm39) I201N possibly damaging Het
Or6c208 G A 10: 129,223,915 (GRCm39) V138M probably benign Het
Or8k40 T A 2: 86,584,906 (GRCm39) M59L possibly damaging Het
Pde8b C T 13: 95,178,447 (GRCm39) A566T possibly damaging Het
Pds5b T A 5: 150,724,066 (GRCm39) S1214R probably benign Het
Pld1 T C 3: 28,083,393 (GRCm39) I171T probably benign Het
Plekha5 T A 6: 140,496,912 (GRCm39) V154E probably damaging Het
Plxna2 A T 1: 194,494,458 (GRCm39) I1892L probably benign Het
Ppp1r16b A G 2: 158,603,383 (GRCm39) Y436C possibly damaging Het
Proc T A 18: 32,260,526 (GRCm39) T200S probably benign Het
Psap T G 10: 60,136,630 (GRCm39) C536W probably damaging Het
Ptger2 G A 14: 45,226,471 (GRCm39) R17H possibly damaging Het
Rab42 A G 4: 132,030,504 (GRCm39) F49L possibly damaging Het
Racgap1 C A 15: 99,524,087 (GRCm39) S440I probably benign Het
Rdh10 G A 1: 16,201,287 (GRCm39) probably benign Het
Rnft2 T A 5: 118,370,471 (GRCm39) S244C probably damaging Het
Sftpc T C 14: 70,759,718 (GRCm39) probably null Het
Shcbp1 A C 8: 4,789,178 (GRCm39) V547G probably damaging Het
Slc6a13 T C 6: 121,302,104 (GRCm39) S229P probably damaging Het
Soat2 A T 15: 102,066,144 (GRCm39) probably benign Het
Swap70 A G 7: 109,867,079 (GRCm39) K294E probably benign Het
Tcim C A 8: 24,928,725 (GRCm39) R63L probably damaging Het
Tek G A 4: 94,751,898 (GRCm39) V1013I probably damaging Het
Tg T A 15: 66,607,120 (GRCm39) M219K probably benign Het
Tie1 A G 4: 118,343,808 (GRCm39) S45P possibly damaging Het
Tmem59 A T 4: 107,047,915 (GRCm39) probably benign Het
Togaram1 A T 12: 65,029,224 (GRCm39) E882D possibly damaging Het
Tram1l1 T A 3: 124,115,509 (GRCm39) M223K possibly damaging Het
Tssk5 C T 15: 76,256,668 (GRCm39) R280Q probably benign Het
Uspl1 T A 5: 149,151,405 (GRCm39) D669E probably damaging Het
Vav1 C A 17: 57,606,839 (GRCm39) probably null Het
Vcl A T 14: 21,065,007 (GRCm39) E634V probably benign Het
Zfp672 A T 11: 58,207,281 (GRCm39) C347S probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9,247,443 (GRCm39) missense probably benign 0.24
IGL00481:Abca13 APN 11 9,240,969 (GRCm39) missense probably damaging 0.99
IGL00707:Abca13 APN 11 9,241,586 (GRCm39) missense probably damaging 0.99
IGL00755:Abca13 APN 11 9,492,102 (GRCm39) missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9,240,870 (GRCm39) missense probably damaging 1.00
IGL00802:Abca13 APN 11 9,247,717 (GRCm39) missense probably damaging 0.96
IGL00807:Abca13 APN 11 9,328,285 (GRCm39) missense probably benign 0.10
IGL00977:Abca13 APN 11 9,349,284 (GRCm39) missense probably damaging 1.00
IGL01064:Abca13 APN 11 9,433,855 (GRCm39) missense probably benign 0.01
IGL01100:Abca13 APN 11 9,224,673 (GRCm39) splice site probably null
IGL01290:Abca13 APN 11 9,206,232 (GRCm39) missense probably damaging 1.00
IGL01299:Abca13 APN 11 9,248,743 (GRCm39) missense probably benign 0.22
IGL01302:Abca13 APN 11 9,349,470 (GRCm39) splice site probably benign
IGL01307:Abca13 APN 11 9,247,159 (GRCm39) missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9,242,076 (GRCm39) missense probably benign 0.05
IGL01351:Abca13 APN 11 9,217,565 (GRCm39) missense probably benign 0.28
IGL01446:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01453:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01461:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01476:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01506:Abca13 APN 11 9,247,447 (GRCm39) missense probably benign 0.36
IGL01527:Abca13 APN 11 9,240,788 (GRCm39) missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9,259,020 (GRCm39) missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9,243,527 (GRCm39) missense probably benign 0.00
IGL01679:Abca13 APN 11 9,248,071 (GRCm39) missense probably benign 0.07
IGL01731:Abca13 APN 11 9,199,749 (GRCm39) splice site probably benign
IGL01762:Abca13 APN 11 9,265,423 (GRCm39) missense probably benign 0.18
IGL01781:Abca13 APN 11 9,349,280 (GRCm39) missense probably damaging 1.00
IGL01802:Abca13 APN 11 9,242,438 (GRCm39) missense probably benign 0.00
IGL01809:Abca13 APN 11 9,240,339 (GRCm39) missense probably damaging 0.96
IGL01906:Abca13 APN 11 9,166,225 (GRCm39) missense probably damaging 1.00
IGL01928:Abca13 APN 11 9,633,342 (GRCm39) missense probably benign 0.13
IGL01940:Abca13 APN 11 9,517,661 (GRCm39) splice site probably benign
IGL01993:Abca13 APN 11 9,208,452 (GRCm39) unclassified probably benign
IGL02039:Abca13 APN 11 9,247,193 (GRCm39) nonsense probably null
IGL02159:Abca13 APN 11 9,264,545 (GRCm39) missense probably benign 0.00
IGL02202:Abca13 APN 11 9,238,529 (GRCm39) missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9,240,626 (GRCm39) missense probably benign 0.00
IGL02332:Abca13 APN 11 9,241,482 (GRCm39) missense probably damaging 0.98
IGL02380:Abca13 APN 11 9,241,599 (GRCm39) missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9,247,527 (GRCm39) missense probably benign 0.00
IGL02505:Abca13 APN 11 9,531,498 (GRCm39) missense probably damaging 1.00
IGL02507:Abca13 APN 11 9,349,388 (GRCm39) missense probably damaging 1.00
IGL02558:Abca13 APN 11 9,349,387 (GRCm39) missense probably damaging 1.00
IGL02581:Abca13 APN 11 9,349,132 (GRCm39) splice site probably benign
IGL02586:Abca13 APN 11 9,243,983 (GRCm39) missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9,381,898 (GRCm39) missense probably damaging 1.00
IGL02747:Abca13 APN 11 9,323,282 (GRCm39) nonsense probably null
IGL02893:Abca13 APN 11 9,240,543 (GRCm39) missense probably damaging 0.96
IGL02930:Abca13 APN 11 9,328,226 (GRCm39) missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9,328,291 (GRCm39) missense probably damaging 0.99
IGL02983:Abca13 APN 11 9,240,663 (GRCm39) missense probably benign 0.40
IGL02999:Abca13 APN 11 9,531,757 (GRCm39) splice site probably benign
IGL03100:Abca13 APN 11 9,208,527 (GRCm39) missense probably benign 0.25
IGL03114:Abca13 APN 11 9,478,999 (GRCm39) missense probably benign 0.06
IGL03230:Abca13 APN 11 9,244,313 (GRCm39) missense probably benign 0.02
IGL03329:Abca13 APN 11 9,248,047 (GRCm39) missense probably benign 0.08
IGL03380:Abca13 APN 11 9,248,574 (GRCm39) missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9,401,515 (GRCm39) missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9,244,962 (GRCm39) missense probably benign
PIT4458001:Abca13 UTSW 11 9,248,304 (GRCm39) missense probably benign 0.05
R0017:Abca13 UTSW 11 9,242,775 (GRCm39) missense probably damaging 0.99
R0079:Abca13 UTSW 11 9,243,493 (GRCm39) missense probably benign 0.00
R0089:Abca13 UTSW 11 9,242,886 (GRCm39) missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0113:Abca13 UTSW 11 9,242,114 (GRCm39) missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0152:Abca13 UTSW 11 9,531,724 (GRCm39) missense probably damaging 0.98
R0255:Abca13 UTSW 11 9,531,545 (GRCm39) missense probably damaging 1.00
R0277:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0278:Abca13 UTSW 11 9,328,215 (GRCm39) missense probably damaging 1.00
R0294:Abca13 UTSW 11 9,219,122 (GRCm39) splice site probably null
R0299:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0310:Abca13 UTSW 11 9,243,810 (GRCm39) missense probably benign 0.36
R0317:Abca13 UTSW 11 9,243,459 (GRCm39) missense probably damaging 1.00
R0323:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0324:Abca13 UTSW 11 9,247,669 (GRCm39) missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9,349,430 (GRCm39) missense probably damaging 0.97
R0336:Abca13 UTSW 11 9,248,481 (GRCm39) missense probably benign 0.04
R0346:Abca13 UTSW 11 9,516,278 (GRCm39) missense probably damaging 0.99
R0380:Abca13 UTSW 11 9,538,500 (GRCm39) splice site probably null
R0382:Abca13 UTSW 11 9,586,650 (GRCm39) splice site probably benign
R0482:Abca13 UTSW 11 9,278,207 (GRCm39) missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9,281,687 (GRCm39) missense probably benign 0.07
R0491:Abca13 UTSW 11 9,248,235 (GRCm39) missense probably benign 0.02
R0496:Abca13 UTSW 11 9,241,701 (GRCm39) missense probably benign 0.01
R0505:Abca13 UTSW 11 9,241,058 (GRCm39) missense probably benign 0.00
R0511:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign
R0525:Abca13 UTSW 11 9,243,371 (GRCm39) missense probably damaging 1.00
R0538:Abca13 UTSW 11 9,217,622 (GRCm39) critical splice donor site probably null
R0615:Abca13 UTSW 11 9,206,197 (GRCm39) missense probably damaging 0.96
R0634:Abca13 UTSW 11 9,264,491 (GRCm39) missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9,538,508 (GRCm39) splice site probably benign
R0848:Abca13 UTSW 11 9,632,011 (GRCm39) nonsense probably null
R0883:Abca13 UTSW 11 9,241,238 (GRCm39) nonsense probably null
R0892:Abca13 UTSW 11 9,248,305 (GRCm39) missense probably benign 0.00
R0904:Abca13 UTSW 11 9,248,740 (GRCm39) missense probably benign 0.22
R0968:Abca13 UTSW 11 9,248,016 (GRCm39) missense probably benign 0.00
R1187:Abca13 UTSW 11 9,478,981 (GRCm39) missense probably benign 0.00
R1299:Abca13 UTSW 11 9,244,821 (GRCm39) missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9,241,836 (GRCm39) missense probably benign
R1387:Abca13 UTSW 11 9,632,085 (GRCm39) nonsense probably null
R1436:Abca13 UTSW 11 9,242,646 (GRCm39) missense probably damaging 0.99
R1449:Abca13 UTSW 11 9,248,580 (GRCm39) missense probably damaging 1.00
R1450:Abca13 UTSW 11 9,380,531 (GRCm39) splice site probably benign
R1462:Abca13 UTSW 11 9,433,924 (GRCm39) splice site probably benign
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1466:Abca13 UTSW 11 9,520,536 (GRCm39) splice site probably benign
R1494:Abca13 UTSW 11 9,416,429 (GRCm39) nonsense probably null
R1559:Abca13 UTSW 11 9,349,180 (GRCm39) missense probably null 1.00
R1564:Abca13 UTSW 11 9,384,316 (GRCm39) nonsense probably null
R1698:Abca13 UTSW 11 9,264,507 (GRCm39) missense probably benign 0.13
R1728:Abca13 UTSW 11 9,199,680 (GRCm39) missense probably benign 0.02
R1734:Abca13 UTSW 11 9,535,460 (GRCm39) missense probably benign 0.03
R1781:Abca13 UTSW 11 9,219,194 (GRCm39) missense probably damaging 1.00
R1782:Abca13 UTSW 11 9,247,971 (GRCm39) missense probably benign 0.36
R1807:Abca13 UTSW 11 9,241,755 (GRCm39) missense probably damaging 0.98
R1830:Abca13 UTSW 11 9,240,350 (GRCm39) missense probably benign 0.04
R1869:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1870:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1871:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1903:Abca13 UTSW 11 9,416,411 (GRCm39) missense probably benign 0.13
R1916:Abca13 UTSW 11 9,484,456 (GRCm39) missense probably damaging 1.00
R1936:Abca13 UTSW 11 9,243,595 (GRCm39) missense probably benign 0.13
R1976:Abca13 UTSW 11 9,347,815 (GRCm39) missense probably damaging 1.00
R2001:Abca13 UTSW 11 9,223,967 (GRCm39) missense probably benign 0.01
R2007:Abca13 UTSW 11 9,141,987 (GRCm39) missense probably benign 0.19
R2016:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2017:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2034:Abca13 UTSW 11 9,242,628 (GRCm39) missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9,278,098 (GRCm39) missense probably benign 0.04
R2075:Abca13 UTSW 11 9,472,382 (GRCm39) missense probably damaging 1.00
R2118:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2120:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2124:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2148:Abca13 UTSW 11 9,565,764 (GRCm39) missense probably damaging 1.00
R2149:Abca13 UTSW 11 9,217,508 (GRCm39) missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9,527,170 (GRCm39) missense probably damaging 0.97
R2167:Abca13 UTSW 11 9,238,532 (GRCm39) missense probably benign 0.19
R2261:Abca13 UTSW 11 9,242,288 (GRCm39) missense probably benign
R2263:Abca13 UTSW 11 9,224,702 (GRCm39) missense probably benign 0.04
R2281:Abca13 UTSW 11 9,278,136 (GRCm39) missense probably damaging 0.98
R2340:Abca13 UTSW 11 9,349,165 (GRCm39) missense probably damaging 0.99
R2357:Abca13 UTSW 11 9,247,336 (GRCm39) missense probably damaging 1.00
R2370:Abca13 UTSW 11 9,206,185 (GRCm39) missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9,217,450 (GRCm39) splice site probably benign
R2393:Abca13 UTSW 11 9,225,057 (GRCm39) nonsense probably null
R2432:Abca13 UTSW 11 9,401,333 (GRCm39) splice site probably benign
R2446:Abca13 UTSW 11 9,225,101 (GRCm39) missense probably benign
R2568:Abca13 UTSW 11 9,283,310 (GRCm39) missense probably benign 0.40
R2847:Abca13 UTSW 11 9,244,584 (GRCm39) missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2861:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2862:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2877:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9,266,119 (GRCm39) splice site probably benign
R3789:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R3933:Abca13 UTSW 11 9,304,856 (GRCm39) missense probably damaging 1.00
R3981:Abca13 UTSW 11 9,482,407 (GRCm39) missense probably benign
R4002:Abca13 UTSW 11 9,535,415 (GRCm39) missense probably benign 0.00
R4010:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4011:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4127:Abca13 UTSW 11 9,141,973 (GRCm39) missense probably benign 0.00
R4214:Abca13 UTSW 11 9,243,877 (GRCm39) missense probably damaging 0.96
R4236:Abca13 UTSW 11 9,206,205 (GRCm39) missense probably damaging 1.00
R4237:Abca13 UTSW 11 9,384,188 (GRCm39) missense probably benign 0.01
R4359:Abca13 UTSW 11 9,247,629 (GRCm39) missense probably benign 0.02
R4378:Abca13 UTSW 11 9,243,644 (GRCm39) missense probably benign 0.00
R4389:Abca13 UTSW 11 9,247,878 (GRCm39) missense probably damaging 0.98
R4392:Abca13 UTSW 11 9,259,034 (GRCm39) missense possibly damaging 0.94
R4684:Abca13 UTSW 11 9,384,193 (GRCm39) nonsense probably null
R4691:Abca13 UTSW 11 9,384,195 (GRCm39) missense probably damaging 1.00
R4700:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9,226,990 (GRCm39) missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9,227,973 (GRCm39) critical splice donor site probably null
R4772:Abca13 UTSW 11 9,265,339 (GRCm39) splice site probably null
R4782:Abca13 UTSW 11 9,278,096 (GRCm39) missense probably damaging 0.96
R4801:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9,492,077 (GRCm39) nonsense probably null
R4851:Abca13 UTSW 11 9,433,890 (GRCm39) missense probably benign 0.02
R4857:Abca13 UTSW 11 9,244,143 (GRCm39) missense probably benign 0.22
R4869:Abca13 UTSW 11 9,265,434 (GRCm39) splice site probably null
R4982:Abca13 UTSW 11 9,242,348 (GRCm39) missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9,247,678 (GRCm39) missense probably damaging 0.99
R5044:Abca13 UTSW 11 9,323,323 (GRCm39) missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9,208,535 (GRCm39) missense probably damaging 1.00
R5155:Abca13 UTSW 11 9,482,447 (GRCm39) missense probably damaging 0.98
R5173:Abca13 UTSW 11 9,632,032 (GRCm39) frame shift probably null
R5180:Abca13 UTSW 11 9,416,510 (GRCm39) missense probably benign 0.01
R5244:Abca13 UTSW 11 9,225,081 (GRCm39) missense probably benign 0.28
R5257:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9,381,861 (GRCm39) missense probably damaging 1.00
R5363:Abca13 UTSW 11 9,227,035 (GRCm39) missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9,578,629 (GRCm39) missense probably damaging 1.00
R5419:Abca13 UTSW 11 9,143,533 (GRCm39) critical splice donor site probably null
R5426:Abca13 UTSW 11 9,240,722 (GRCm39) missense probably damaging 1.00
R5468:Abca13 UTSW 11 9,244,062 (GRCm39) missense probably damaging 1.00
R5477:Abca13 UTSW 11 9,251,298 (GRCm39) missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.00
R5553:Abca13 UTSW 11 9,278,158 (GRCm39) missense probably damaging 1.00
R5556:Abca13 UTSW 11 9,208,546 (GRCm39) missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9,244,615 (GRCm39) nonsense probably null
R5582:Abca13 UTSW 11 9,586,639 (GRCm39) splice site probably null
R5604:Abca13 UTSW 11 9,516,279 (GRCm39) missense probably damaging 0.97
R5609:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R5617:Abca13 UTSW 11 9,227,891 (GRCm39) missense probably benign 0.00
R5693:Abca13 UTSW 11 9,266,233 (GRCm39) missense probably benign 0.29
R5707:Abca13 UTSW 11 9,460,620 (GRCm39) missense probably damaging 1.00
R5725:Abca13 UTSW 11 9,527,181 (GRCm39) missense probably benign 0.00
R5728:Abca13 UTSW 11 9,520,576 (GRCm39) missense probably damaging 1.00
R5738:Abca13 UTSW 11 9,571,917 (GRCm39) missense probably damaging 1.00
R5758:Abca13 UTSW 11 9,264,536 (GRCm39) missense probably damaging 0.97
R5762:Abca13 UTSW 11 9,531,665 (GRCm39) missense probably damaging 1.00
R5771:Abca13 UTSW 11 9,241,411 (GRCm39) missense probably damaging 1.00
R5809:Abca13 UTSW 11 9,243,692 (GRCm39) missense probably damaging 1.00
R5826:Abca13 UTSW 11 9,632,056 (GRCm39) missense probably damaging 0.99
R5831:Abca13 UTSW 11 9,517,777 (GRCm39) nonsense probably null
R5834:Abca13 UTSW 11 9,227,974 (GRCm39) critical splice donor site probably null
R5902:Abca13 UTSW 11 9,247,177 (GRCm39) missense probably damaging 1.00
R5933:Abca13 UTSW 11 9,199,658 (GRCm39) missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9,243,398 (GRCm39) missense probably benign 0.04
R5969:Abca13 UTSW 11 9,242,214 (GRCm39) nonsense probably null
R5985:Abca13 UTSW 11 9,241,628 (GRCm39) missense probably benign 0.02
R5998:Abca13 UTSW 11 9,517,708 (GRCm39) missense probably damaging 0.97
R6021:Abca13 UTSW 11 9,240,465 (GRCm39) nonsense probably null
R6022:Abca13 UTSW 11 9,240,759 (GRCm39) missense probably damaging 1.00
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9,347,812 (GRCm39) missense probably damaging 1.00
R6153:Abca13 UTSW 11 9,251,259 (GRCm39) critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9,259,047 (GRCm39) missense probably damaging 1.00
R6187:Abca13 UTSW 11 9,259,085 (GRCm39) missense probably damaging 1.00
R6247:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R6329:Abca13 UTSW 11 9,227,937 (GRCm39) missense probably damaging 1.00
R6352:Abca13 UTSW 11 9,259,139 (GRCm39) splice site probably null
R6367:Abca13 UTSW 11 9,166,248 (GRCm39) missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9,248,778 (GRCm39) missense probably benign 0.01
R6424:Abca13 UTSW 11 9,460,542 (GRCm39) missense probably benign
R6456:Abca13 UTSW 11 9,240,474 (GRCm39) missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9,248,661 (GRCm39) missense probably benign 0.00
R6547:Abca13 UTSW 11 9,224,757 (GRCm39) missense probably benign 0.04
R6594:Abca13 UTSW 11 9,244,632 (GRCm39) missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9,328,384 (GRCm39) missense probably damaging 1.00
R6614:Abca13 UTSW 11 9,244,371 (GRCm39) missense probably benign 0.04
R6736:Abca13 UTSW 11 9,415,058 (GRCm39) missense probably damaging 1.00
R6742:Abca13 UTSW 11 9,278,168 (GRCm39) missense probably damaging 1.00
R6791:Abca13 UTSW 11 9,328,504 (GRCm39) missense probably damaging 1.00
R6834:Abca13 UTSW 11 9,225,110 (GRCm39) missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9,248,568 (GRCm39) missense probably damaging 0.96
R6955:Abca13 UTSW 11 9,244,307 (GRCm39) missense probably benign 0.28
R7031:Abca13 UTSW 11 9,571,892 (GRCm39) missense probably damaging 1.00
R7065:Abca13 UTSW 11 9,242,595 (GRCm39) missense probably benign 0.02
R7067:Abca13 UTSW 11 9,241,845 (GRCm39) missense probably benign 0.14
R7070:Abca13 UTSW 11 9,240,701 (GRCm39) missense probably benign 0.06
R7094:Abca13 UTSW 11 9,248,610 (GRCm39) missense probably damaging 0.96
R7102:Abca13 UTSW 11 9,285,215 (GRCm39) missense probably damaging 1.00
R7105:Abca13 UTSW 11 9,347,842 (GRCm39) missense probably damaging 1.00
R7131:Abca13 UTSW 11 9,241,893 (GRCm39) missense probably benign 0.37
R7155:Abca13 UTSW 11 9,479,010 (GRCm39) missense probably benign
R7158:Abca13 UTSW 11 9,223,982 (GRCm39) missense probably benign
R7212:Abca13 UTSW 11 9,248,854 (GRCm39) missense probably benign 0.04
R7215:Abca13 UTSW 11 9,238,405 (GRCm39) splice site probably null
R7228:Abca13 UTSW 11 9,247,653 (GRCm39) missense probably benign
R7231:Abca13 UTSW 11 9,244,175 (GRCm39) missense probably benign 0.25
R7247:Abca13 UTSW 11 9,240,732 (GRCm39) missense probably benign 0.00
R7278:Abca13 UTSW 11 9,241,126 (GRCm39) missense possibly damaging 0.56
R7299:Abca13 UTSW 11 9,244,649 (GRCm39) missense probably damaging 0.98
R7304:Abca13 UTSW 11 9,247,203 (GRCm39) missense probably benign
R7328:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.14
R7374:Abca13 UTSW 11 9,242,136 (GRCm39) missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9,241,118 (GRCm39) missense probably benign 0.00
R7384:Abca13 UTSW 11 9,283,257 (GRCm39) missense probably damaging 1.00
R7395:Abca13 UTSW 11 9,241,658 (GRCm39) missense probably benign 0.01
R7419:Abca13 UTSW 11 9,247,833 (GRCm39) missense probably damaging 1.00
R7419:Abca13 UTSW 11 9,226,959 (GRCm39) missense probably damaging 1.00
R7421:Abca13 UTSW 11 9,460,463 (GRCm39) missense probably benign
R7458:Abca13 UTSW 11 9,240,777 (GRCm39) missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9,278,088 (GRCm39) nonsense probably null
R7492:Abca13 UTSW 11 9,243,167 (GRCm39) missense probably benign 0.08
R7660:Abca13 UTSW 11 9,240,678 (GRCm39) missense probably benign 0.00
R7677:Abca13 UTSW 11 9,248,349 (GRCm39) nonsense probably null
R7744:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9,247,915 (GRCm39) missense probably damaging 1.00
R7798:Abca13 UTSW 11 9,241,664 (GRCm39) missense probably benign 0.04
R7811:Abca13 UTSW 11 9,527,141 (GRCm39) splice site probably null
R7831:Abca13 UTSW 11 9,247,404 (GRCm39) missense possibly damaging 0.46
R7867:Abca13 UTSW 11 9,212,139 (GRCm39) critical splice donor site probably null
R7910:Abca13 UTSW 11 9,531,590 (GRCm39) missense probably damaging 1.00
R7964:Abca13 UTSW 11 9,266,146 (GRCm39) missense probably benign 0.06
R8037:Abca13 UTSW 11 9,243,904 (GRCm39) missense probably damaging 1.00
R8049:Abca13 UTSW 11 9,241,867 (GRCm39) missense probably damaging 0.99
R8059:Abca13 UTSW 11 9,323,279 (GRCm39) missense probably benign 0.00
R8072:Abca13 UTSW 11 9,244,574 (GRCm39) missense probably benign 0.10
R8078:Abca13 UTSW 11 9,251,279 (GRCm39) missense probably benign 0.32
R8112:Abca13 UTSW 11 9,264,624 (GRCm39) missense probably benign 0.01
R8146:Abca13 UTSW 11 9,347,829 (GRCm39) missense probably damaging 1.00
R8164:Abca13 UTSW 11 9,565,799 (GRCm39) missense probably damaging 1.00
R8195:Abca13 UTSW 11 9,224,735 (GRCm39) missense probably benign 0.00
R8220:Abca13 UTSW 11 9,384,299 (GRCm39) missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9,212,077 (GRCm39) missense probably damaging 0.99
R8307:Abca13 UTSW 11 9,227,922 (GRCm39) nonsense probably null
R8310:Abca13 UTSW 11 9,328,269 (GRCm39) missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9,535,502 (GRCm39) missense probably benign 0.44
R8315:Abca13 UTSW 11 9,328,460 (GRCm39) missense probably null 1.00
R8324:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,347,841 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,265,416 (GRCm39) missense probably benign 0.00
R8400:Abca13 UTSW 11 9,248,218 (GRCm39) missense probably damaging 0.97
R8400:Abca13 UTSW 11 9,243,925 (GRCm39) missense probably benign 0.00
R8425:Abca13 UTSW 11 9,264,623 (GRCm39) missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9,225,092 (GRCm39) missense probably benign 0.00
R8493:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R8502:Abca13 UTSW 11 9,219,282 (GRCm39) missense probably benign 0.02
R8716:Abca13 UTSW 11 9,243,774 (GRCm39) missense probably benign 0.09
R8787:Abca13 UTSW 11 9,225,053 (GRCm39) missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9,571,881 (GRCm39) missense probably damaging 1.00
R8859:Abca13 UTSW 11 9,328,397 (GRCm39) missense
R8871:Abca13 UTSW 11 9,248,071 (GRCm39) missense probably benign 0.07
R8883:Abca13 UTSW 11 9,283,168 (GRCm39) missense probably benign 0.00
R8919:Abca13 UTSW 11 9,241,653 (GRCm39) missense possibly damaging 0.84
R8966:Abca13 UTSW 11 9,578,588 (GRCm39) missense probably damaging 1.00
R8967:Abca13 UTSW 11 9,242,696 (GRCm39) missense probably benign 0.18
R8969:Abca13 UTSW 11 9,227,944 (GRCm39) missense probably benign
R8972:Abca13 UTSW 11 9,278,138 (GRCm39) missense probably damaging 1.00
R9002:Abca13 UTSW 11 9,241,926 (GRCm39) missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9,243,525 (GRCm39) missense probably benign 0.04
R9051:Abca13 UTSW 11 9,285,232 (GRCm39) missense probably damaging 1.00
R9056:Abca13 UTSW 11 9,414,921 (GRCm39) missense probably damaging 1.00
R9061:Abca13 UTSW 11 9,227,847 (GRCm39) missense probably benign 0.02
R9072:Abca13 UTSW 11 9,240,834 (GRCm39) missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9127:Abca13 UTSW 11 9,242,080 (GRCm39) missense probably benign 0.03
R9164:Abca13 UTSW 11 9,278,157 (GRCm39) missense probably damaging 1.00
R9175:Abca13 UTSW 11 9,531,593 (GRCm39) missense probably damaging 0.98
R9190:Abca13 UTSW 11 9,241,886 (GRCm39) missense probably damaging 0.96
R9244:Abca13 UTSW 11 9,241,577 (GRCm39) missense probably benign 0.01
R9255:Abca13 UTSW 11 9,278,213 (GRCm39) missense probably damaging 1.00
R9271:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9321:Abca13 UTSW 11 9,460,475 (GRCm39) missense probably benign 0.00
R9356:Abca13 UTSW 11 9,206,305 (GRCm39) missense probably benign 0.11
R9369:Abca13 UTSW 11 9,328,444 (GRCm39) missense probably damaging 1.00
R9423:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R9432:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign 0.00
R9455:Abca13 UTSW 11 9,353,897 (GRCm39) missense probably damaging 1.00
R9486:Abca13 UTSW 11 9,240,621 (GRCm39) missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9,243,667 (GRCm39) nonsense probably null
R9511:Abca13 UTSW 11 9,278,130 (GRCm39) missense probably benign 0.16
R9545:Abca13 UTSW 11 9,416,538 (GRCm39) missense probably damaging 1.00
R9566:Abca13 UTSW 11 9,414,927 (GRCm39) missense probably damaging 1.00
R9609:Abca13 UTSW 11 9,208,549 (GRCm39) missense probably damaging 1.00
R9616:Abca13 UTSW 11 9,240,501 (GRCm39) missense probably benign 0.00
R9651:Abca13 UTSW 11 9,535,484 (GRCm39) missense probably benign
R9651:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9653:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9657:Abca13 UTSW 11 9,243,379 (GRCm39) missense probably benign 0.35
R9684:Abca13 UTSW 11 9,283,307 (GRCm39) missense probably damaging 1.00
X0013:Abca13 UTSW 11 9,223,899 (GRCm39) missense probably benign 0.02
X0057:Abca13 UTSW 11 9,244,744 (GRCm39) missense probably damaging 0.96
X0066:Abca13 UTSW 11 9,217,565 (GRCm39) missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9,244,687 (GRCm39) missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9,217,461 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,201,376 (GRCm39) missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9,285,182 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,285,181 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,244,342 (GRCm39) missense probably benign 0.01
Z1177:Abca13 UTSW 11 9,264,545 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAACAATTTTCTGAGCTTGAGCTG -3'
(R):5'- TGTGAAACCCCTAAGACTTGAACAG -3'

Sequencing Primer
(F):5'- CTTGAGCTGGTCAGGTGAGAAC -3'
(R):5'- TAGCTGAGTACTAGCCAAGCCTTG -3'
Posted On 2015-09-25