Incidental Mutation 'R4623:Cts6'
ID346357
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Namecathepsin 6
Synonyms
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61195132-61203410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61202160 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 36 (Y36N)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021890
AA Change: Y36N

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: Y36N

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Proc T A 18: 32,127,473 T200S probably benign Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61198339 splice site probably benign
IGL00774:Cts6 APN 13 61198339 splice site probably benign
IGL02237:Cts6 APN 13 61197499 missense probably benign 0.01
IGL03071:Cts6 APN 13 61202250 missense probably damaging 0.97
IGL03224:Cts6 APN 13 61201733 missense probably damaging 1.00
IGL03282:Cts6 APN 13 61196447 missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61196457 splice site probably benign
R0201:Cts6 UTSW 13 61201499 nonsense probably null
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0401:Cts6 UTSW 13 61198339 splice site probably benign
R0676:Cts6 UTSW 13 61197484 splice site probably benign
R1471:Cts6 UTSW 13 61196380 missense probably benign 0.00
R1594:Cts6 UTSW 13 61198367 missense probably damaging 1.00
R1864:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1865:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1902:Cts6 UTSW 13 61201515 nonsense probably null
R2097:Cts6 UTSW 13 61195445 missense probably damaging 1.00
R2235:Cts6 UTSW 13 61195433 missense probably damaging 1.00
R2829:Cts6 UTSW 13 61201497 missense probably benign 0.01
R2910:Cts6 UTSW 13 61196401 missense probably damaging 1.00
R3757:Cts6 UTSW 13 61202158 nonsense probably null
R4460:Cts6 UTSW 13 61195458 missense probably benign 0.25
R4553:Cts6 UTSW 13 61197593 missense probably damaging 1.00
R4793:Cts6 UTSW 13 61201812 missense probably benign 0.00
R4809:Cts6 UTSW 13 61202181 missense probably damaging 1.00
R4849:Cts6 UTSW 13 61201601 missense probably null
R4866:Cts6 UTSW 13 61202276 critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61196350 missense probably damaging 1.00
R5590:Cts6 UTSW 13 61201812 missense probably benign 0.00
R6236:Cts6 UTSW 13 61196378 nonsense probably null
R6428:Cts6 UTSW 13 61196423 missense probably damaging 0.96
R6501:Cts6 UTSW 13 61196335 missense probably damaging 1.00
R6508:Cts6 UTSW 13 61196407 missense probably damaging 1.00
R6643:Cts6 UTSW 13 61201793 missense probably damaging 0.96
R7397:Cts6 UTSW 13 61202200 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGACACTGTCACCATTCTTTGC -3'
(R):5'- TGACCGTAGATACCTTAATTTCCG -3'

Sequencing Primer
(F):5'- CCATTCTTTGCATACTGAGGAAAGGG -3'
(R):5'- CGTAGATACCTTAATTTCCGAGGAAG -3'
Posted On2015-09-25