Incidental Mutation 'R4623:Proc'
ID346375
Institutional Source Beutler Lab
Gene Symbol Proc
Ensembl Gene ENSMUSG00000024386
Gene Nameprotein C
SynonymsPC, inactivator of coagulation factors Va, VIII
MMRRC Submission 041888-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4623 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32123129-32139570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32127473 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 200 (T200S)
Ref Sequence ENSEMBL: ENSMUSP00000132226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171765]
Predicted Effect probably benign
Transcript: ENSMUST00000171765
AA Change: T200S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132226
Gene: ENSMUSG00000024386
AA Change: T200S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GLA 24 86 6.66e-30 SMART
EGF_CA 87 131 1.25e-6 SMART
EGF 138 175 3.62e-3 SMART
low complexity region 201 210 N/A INTRINSIC
Tryp_SPc 211 444 2.6e-82 SMART
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: This gene encodes the vitamin K-dependent protein C, which plays a vital role in the anticoagulation pathway. The encoded protein undergoes proteolytic processing including activation by thrombin-thrombomodulin complex to form the anticoagulant serine protease that degrades activated coagulation factors. A complete lack of the encoded protein in mice results in severe perinatal consumptive coagulopathy in the brain and liver, resulting in death within 24 hours after birth. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Inactivation of the locus results in death within 24 hours of birth due to consumptive coagulopathy. Thromboses and bleeding are observed in the brains and livers of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,398 N404D possibly damaging Het
1700034J04Rik T C 12: 11,222,140 noncoding transcript Het
A930003A15Rik C T 16: 19,883,737 noncoding transcript Het
Abca13 A G 11: 9,309,130 Y2952C probably damaging Het
Actrt2 T C 4: 154,667,290 T130A probably benign Het
Adamts7 T A 9: 90,186,462 D475E probably benign Het
Adgrf5 A G 17: 43,450,983 S1190G probably benign Het
Adgrg6 A T 10: 14,441,499 C526S probably damaging Het
Aldoc T C 11: 78,325,121 V151A probably damaging Het
Arsj A T 3: 126,364,796 E8V probably benign Het
Asph T C 4: 9,622,005 K167E possibly damaging Het
Auts2 G A 5: 131,440,383 P475S probably benign Het
C1d A G 11: 17,262,742 D29G possibly damaging Het
Calb1 T A 4: 15,895,721 probably benign Het
Ceacam15 A T 7: 16,673,466 F42Y probably damaging Het
Cpm A G 10: 117,670,297 N188D possibly damaging Het
Cts6 A T 13: 61,202,160 Y36N possibly damaging Het
Cux1 T C 5: 136,308,300 K657R probably damaging Het
Cyp2a22 G T 7: 26,933,491 P429T probably damaging Het
Dock3 T C 9: 107,062,045 E168G possibly damaging Het
Dot1l A G 10: 80,782,150 N324S probably benign Het
Dusp13 A C 14: 21,743,478 probably benign Het
Eif4g1 T A 16: 20,681,345 probably benign Het
Fan1 G T 7: 64,373,553 Y121* probably null Het
Foxn4 T C 5: 114,260,930 E80G possibly damaging Het
Gal3st2c C A 1: 94,009,456 H374Q possibly damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm973 A T 1: 59,556,276 I409F probably damaging Het
Gpr18 T A 14: 121,912,167 T149S probably damaging Het
Gsr A G 8: 33,680,305 E206G probably damaging Het
Hal A G 10: 93,507,439 H515R probably damaging Het
Heatr5b A G 17: 78,795,119 S1277P possibly damaging Het
Hmcn2 A G 2: 31,396,710 E2125G probably damaging Het
Ikzf4 A G 10: 128,641,119 C108R probably damaging Het
Kcnh2 A G 5: 24,348,442 V59A probably benign Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Kif11 A T 19: 37,409,747 I674L probably benign Het
Lrp1b A T 2: 41,246,021 C1646S probably damaging Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Mib1 C A 18: 10,808,086 N944K probably benign Het
Mical3 C A 6: 120,961,625 E262* probably null Het
Mms22l C T 4: 24,502,792 Q55* probably null Het
Mrps11 T C 7: 78,791,941 probably null Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ncapd2 A G 6: 125,173,609 V843A probably benign Het
Nell1 A G 7: 50,120,562 E123G possibly damaging Het
Nkd1 A G 8: 88,589,755 D213G probably benign Het
Nlrp1b T C 11: 71,161,843 T920A probably benign Het
Olfr1090 T A 2: 86,754,562 M59L possibly damaging Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Olfr784 G A 10: 129,388,046 V138M probably benign Het
Pde8b C T 13: 95,041,939 A566T possibly damaging Het
Pds5b T A 5: 150,800,601 S1214R probably benign Het
Pld1 T C 3: 28,029,244 I171T probably benign Het
Plekha5 T A 6: 140,551,186 V154E probably damaging Het
Plxna2 A T 1: 194,812,150 I1892L probably benign Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Psap T G 10: 60,300,851 C536W probably damaging Het
Ptger2 G A 14: 44,989,014 R17H possibly damaging Het
Rab42 A G 4: 132,303,193 F49L possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rdh10 G A 1: 16,131,063 probably benign Het
Rnft2 T A 5: 118,232,406 S244C probably damaging Het
Sftpc T C 14: 70,522,278 probably null Het
Shcbp1 A C 8: 4,739,178 V547G probably damaging Het
Slc6a13 T C 6: 121,325,145 S229P probably damaging Het
Soat2 A T 15: 102,157,709 probably benign Het
Swap70 A G 7: 110,267,872 K294E probably benign Het
Tcim C A 8: 24,438,709 R63L probably damaging Het
Tek G A 4: 94,863,661 V1013I probably damaging Het
Tg T A 15: 66,735,271 M219K probably benign Het
Tie1 A G 4: 118,486,611 S45P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Tram1l1 T A 3: 124,321,860 M223K possibly damaging Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Uspl1 T A 5: 149,214,595 D669E probably damaging Het
Vav1 C A 17: 57,299,839 probably null Het
Vcl A T 14: 21,014,939 E634V probably benign Het
Zfp672 A T 11: 58,316,455 C347S probably benign Het
Other mutations in Proc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Proc APN 18 32123513 missense probably benign 0.05
IGL01071:Proc APN 18 32123717 missense probably damaging 1.00
IGL01287:Proc APN 18 32123820 splice site probably benign
IGL01298:Proc APN 18 32123552 missense probably benign 0.01
IGL01898:Proc APN 18 32133145 critical splice donor site probably null
IGL01977:Proc APN 18 32127419 missense probably benign 0.02
IGL02040:Proc APN 18 32134860 missense probably benign 0.07
IGL02724:Proc APN 18 32134872 missense probably damaging 1.00
IGL02852:Proc APN 18 32125155 missense probably damaging 1.00
IGL02901:Proc APN 18 32123625 missense possibly damaging 0.89
IGL03401:Proc APN 18 32123273 missense possibly damaging 0.96
R0110:Proc UTSW 18 32125118 missense probably benign 0.26
R0131:Proc UTSW 18 32135898 missense probably benign 0.01
R0510:Proc UTSW 18 32125118 missense probably benign 0.26
R0988:Proc UTSW 18 32133483 missense probably benign
R1455:Proc UTSW 18 32123398 missense probably damaging 1.00
R1463:Proc UTSW 18 32133438 missense possibly damaging 0.69
R1546:Proc UTSW 18 32127410 missense probably damaging 1.00
R1711:Proc UTSW 18 32127406 missense probably benign 0.05
R3414:Proc UTSW 18 32123685 missense probably benign 0.00
R3911:Proc UTSW 18 32123705 missense probably damaging 1.00
R4276:Proc UTSW 18 32135914 missense probably benign 0.00
R4598:Proc UTSW 18 32123459 missense probably damaging 1.00
R4758:Proc UTSW 18 32123810 missense probably damaging 0.97
R4941:Proc UTSW 18 32125113 missense possibly damaging 0.60
R5917:Proc UTSW 18 32127460 missense probably benign 0.07
R6349:Proc UTSW 18 32133433 missense probably benign 0.00
R6636:Proc UTSW 18 32123760 missense probably benign 0.00
R6735:Proc UTSW 18 32123648 missense probably benign 0.01
R7110:Proc UTSW 18 32133388 missense probably benign 0.30
R7310:Proc UTSW 18 32135899 missense probably benign 0.03
R7409:Proc UTSW 18 32127460 missense probably benign 0.03
R7597:Proc UTSW 18 32123636 missense probably damaging 1.00
R7598:Proc UTSW 18 32135876 missense probably benign 0.00
X0021:Proc UTSW 18 32123507 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATGCATGCCCTTCCCTGAC -3'
(R):5'- ACTCTTGCTAGTAGGTGGCAC -3'

Sequencing Primer
(F):5'- ACCATGCCCATTTCTATCCATACCAG -3'
(R):5'- GATTTTGAGTCCCACACTGCAC -3'
Posted On2015-09-25