Incidental Mutation 'R4624:Cdh19'
ID346380
Institutional Source Beutler Lab
Gene Symbol Cdh19
Ensembl Gene ENSMUSG00000047216
Gene Namecadherin 19, type 2
Synonyms
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location110888326-110977584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110932251 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 167 (K167E)
Ref Sequence ENSEMBL: ENSMUSP00000092210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094626]
Predicted Effect probably benign
Transcript: ENSMUST00000094626
AA Change: K167E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216
AA Change: K167E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 64 144 2.44e-14 SMART
CA 168 252 3.21e-23 SMART
CA 276 367 6.2e-7 SMART
CA 390 466 2.69e-16 SMART
CA 489 576 6.68e-3 SMART
transmembrane domain 594 616 N/A INTRINSIC
Pfam:Cadherin_C 619 764 1.7e-50 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Fer1l6 T C 15: 58,553,705 I144T probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Helz2 T C 2: 181,239,308 E436G probably damaging Het
Hfe A T 13: 23,706,078 C149* probably null Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lilrb4a A G 10: 51,491,488 Y42C probably damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Olfr1436 C T 19: 12,298,983 V50I probably benign Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Cdh19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Cdh19 APN 1 110949252 missense probably damaging 1.00
IGL00863:Cdh19 APN 1 110949144 missense probably damaging 1.00
IGL01537:Cdh19 APN 1 110919611 missense possibly damaging 0.73
IGL02108:Cdh19 APN 1 110889731 missense probably benign 0.31
IGL02125:Cdh19 APN 1 110929884 missense possibly damaging 0.94
IGL02234:Cdh19 APN 1 110932226 missense probably damaging 1.00
IGL02251:Cdh19 APN 1 110954652 missense probably benign 0.00
IGL02275:Cdh19 APN 1 110925886 missense probably benign 0.21
IGL03203:Cdh19 APN 1 110890098 missense possibly damaging 0.82
R0539:Cdh19 UTSW 1 110925162 missense possibly damaging 0.81
R0594:Cdh19 UTSW 1 110925867 missense probably benign 0.40
R0612:Cdh19 UTSW 1 110893170 splice site probably benign
R1028:Cdh19 UTSW 1 110954584 missense probably benign 0.03
R1627:Cdh19 UTSW 1 110919645 missense probably benign 0.16
R1728:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1729:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1730:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1739:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1762:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1783:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1785:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1974:Cdh19 UTSW 1 110890159 missense possibly damaging 0.50
R2119:Cdh19 UTSW 1 110919590 missense probably benign 0.00
R3026:Cdh19 UTSW 1 110954688 missense probably benign 0.03
R3037:Cdh19 UTSW 1 110954607 missense probably damaging 1.00
R3612:Cdh19 UTSW 1 110893296 missense probably damaging 1.00
R4254:Cdh19 UTSW 1 110925030 missense probably damaging 1.00
R4368:Cdh19 UTSW 1 110889712 nonsense probably null
R4648:Cdh19 UTSW 1 110925177 missense probably benign 0.04
R4720:Cdh19 UTSW 1 110895381 critical splice donor site probably null
R4766:Cdh19 UTSW 1 110893260 missense probably benign 0.39
R4937:Cdh19 UTSW 1 110889964 missense probably damaging 1.00
R4968:Cdh19 UTSW 1 110925228 missense probably benign 0.08
R4970:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5095:Cdh19 UTSW 1 110954661 missense probably benign
R5112:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5586:Cdh19 UTSW 1 110929857 missense probably damaging 1.00
R6431:Cdh19 UTSW 1 110925057 missense probably benign 0.00
R6595:Cdh19 UTSW 1 110925787 missense probably benign 0.15
R6997:Cdh19 UTSW 1 110954866 start gained probably benign
R7240:Cdh19 UTSW 1 110893407 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTCTACCATAGAACATGTTTTCAACC -3'
(R):5'- TCTGCAGAACTTAAGGGAATGAAGTC -3'

Sequencing Primer
(F):5'- CAACCAAATGATTTGTGCAGAC -3'
(R):5'- GGGAAGAACAGCATGATTTTC -3'
Posted On2015-09-25