Incidental Mutation 'R4624:Lilrb4a'
ID346424
Institutional Source Beutler Lab
Gene Symbol Lilrb4a
Ensembl Gene ENSMUSG00000112148
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4A
SynonymsLilrb4, CD85K, ILT3, HM18, Gp49b
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location51490956-51496611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51491488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 42 (Y42C)
Ref Sequence ENSEMBL: ENSMUSP00000151827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078778] [ENSMUST00000102894] [ENSMUST00000217705] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218617] [ENSMUST00000219696] [ENSMUST00000219960] [ENSMUST00000220182] [ENSMUST00000220226]
Predicted Effect probably damaging
Transcript: ENSMUST00000078778
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148
AA Change: Y42C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102894
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105481
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593
AA Change: Y42C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105482
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593
AA Change: Y42C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217705
Predicted Effect probably damaging
Transcript: ENSMUST00000217706
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000218123
AA Change: Y42C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect probably benign
Transcript: ENSMUST00000218617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219388
Predicted Effect probably damaging
Transcript: ENSMUST00000219696
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219848
Predicted Effect probably benign
Transcript: ENSMUST00000219960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220166
Predicted Effect probably damaging
Transcript: ENSMUST00000220182
AA Change: Y42C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000220226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220402
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased sensitivity to IgE-dependent passive cutaneous anaphylaxis and a reduced threshold for antigen challenge in active cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cdh19 T C 1: 110,932,251 K167E probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Fer1l6 T C 15: 58,553,705 I144T probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Helz2 T C 2: 181,239,308 E436G probably damaging Het
Hfe A T 13: 23,706,078 C149* probably null Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Olfr1436 C T 19: 12,298,983 V50I probably benign Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Lilrb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Lilrb4a APN 10 51494065 missense probably benign 0.42
IGL02057:Lilrb4a APN 10 51492007 missense possibly damaging 0.81
IGL02386:Lilrb4a APN 10 51491226 nonsense probably null
IGL02999:Lilrb4a APN 10 51494143 missense probably damaging 1.00
IGL03292:Lilrb4a APN 10 51494846 unclassified probably null
IGL03382:Lilrb4a APN 10 51491520 missense probably benign 0.10
R0276:Lilrb4a UTSW 10 51491581 missense probably benign 0.01
R0470:Lilrb4a UTSW 10 51494827 missense possibly damaging 0.87
R1459:Lilrb4a UTSW 10 51491587 missense probably benign 0.44
R1675:Lilrb4a UTSW 10 51496185 missense probably benign 0.37
R1819:Lilrb4a UTSW 10 51496028 missense probably damaging 1.00
R1914:Lilrb4a UTSW 10 51491949 missense probably benign 0.04
R2265:Lilrb4a UTSW 10 51491537 nonsense probably null
R2338:Lilrb4a UTSW 10 51491700 missense probably benign 0.13
R2884:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R2886:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R4322:Lilrb4a UTSW 10 51491611 missense probably damaging 1.00
R4923:Lilrb4a UTSW 10 51492043 missense possibly damaging 0.67
R5001:Lilrb4a UTSW 10 51491420 splice site probably null
R5262:Lilrb4a UTSW 10 51493207 critical splice donor site probably null
R6224:Lilrb4a UTSW 10 51491649 missense probably damaging 1.00
R7447:Lilrb4a UTSW 10 51491053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTGTCAATTCCTCAAAATGGTG -3'
(R):5'- ATGGCATCACTGTGCTCTGAG -3'

Sequencing Primer
(F):5'- GTCAATTCCTCAAAATGGTGATGGG -3'
(R):5'- ATCACTGTGCTCTGAGAAGCCAG -3'
Posted On2015-09-25