Incidental Mutation 'R4624:Hfe'
ID346440
Institutional Source Beutler Lab
Gene Symbol Hfe
Ensembl Gene ENSMUSG00000006611
Gene Namehemochromatosis
SynonymsMR2
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23702034-23710854 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23706078 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 149 (C149*)
Ref Sequence ENSEMBL: ENSMUSP00000089299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006787] [ENSMUST00000091706] [ENSMUST00000091707]
Predicted Effect probably null
Transcript: ENSMUST00000006787
AA Change: C49*
SMART Domains Protein: ENSMUSP00000006787
Gene: ENSMUSG00000006611
AA Change: C49*

DomainStartEndE-ValueType
IGc1 44 116 1.03e-14 SMART
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091706
AA Change: C237*
SMART Domains Protein: ENSMUSP00000089298
Gene: ENSMUSG00000006611
AA Change: C237*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 30 214 4e-46 PFAM
Pfam:MHC_I_3 53 212 7.4e-12 PFAM
IGc1 232 304 1.03e-14 SMART
transmembrane domain 318 340 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091707
AA Change: C149*
SMART Domains Protein: ENSMUSP00000089299
Gene: ENSMUSG00000006611
AA Change: C149*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:MHC_I 34 126 7.3e-24 PFAM
IGc1 144 216 1.03e-14 SMART
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151243
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene affects iron metabolism. Homozygotes for targeted null mutations exhibit increased intestinal iron absorption and an elevated hepatic iron load but reduced duodenal iron stores. Heterozygotes also accumulate more iron than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cdh19 T C 1: 110,932,251 K167E probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Fer1l6 T C 15: 58,553,705 I144T probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Helz2 T C 2: 181,239,308 E436G probably damaging Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lilrb4a A G 10: 51,491,488 Y42C probably damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Olfr1436 C T 19: 12,298,983 V50I probably benign Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Hfe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Hfe APN 13 23705852 unclassified probably benign
IGL01733:Hfe APN 13 23706865 missense possibly damaging 0.51
IGL02227:Hfe APN 13 23706943 missense probably benign 0.26
IGL02339:Hfe APN 13 23704390 missense probably damaging 0.98
R1669:Hfe UTSW 13 23706127 nonsense probably null
R1704:Hfe UTSW 13 23704408 missense probably damaging 1.00
R4424:Hfe UTSW 13 23706883 missense probably benign 0.06
R4904:Hfe UTSW 13 23708054 missense probably damaging 1.00
R5926:Hfe UTSW 13 23708264 missense probably damaging 0.99
R6246:Hfe UTSW 13 23708229 missense probably damaging 1.00
R6322:Hfe UTSW 13 23705896 missense probably damaging 1.00
R6636:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6636:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R6637:Hfe UTSW 13 23706795 missense possibly damaging 0.53
R6637:Hfe UTSW 13 23706796 missense possibly damaging 0.88
R7167:Hfe UTSW 13 23708069 missense probably damaging 1.00
R7374:Hfe UTSW 13 23706047 missense probably damaging 0.99
R7816:Hfe UTSW 13 23704399 missense possibly damaging 0.53
R8188:Hfe UTSW 13 23708192 missense probably damaging 1.00
Z1177:Hfe UTSW 13 23706037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAACCTTGTCTCGTCC -3'
(R):5'- CAGGATATCAAATGGCATCTCTG -3'

Sequencing Primer
(F):5'- GAACCTTGTCTCGTCCCCAGG -3'
(R):5'- TGTGTGTGTGTGTGTGTGTG -3'
Posted On2015-09-25