Incidental Mutation 'R4624:Rmi1'
ID 346441
Institutional Source Beutler Lab
Gene Symbol Rmi1
Ensembl Gene ENSMUSG00000035367
Gene Name RecQ mediated genome instability 1
Synonyms 4932432N11Rik
MMRRC Submission 041889-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R4624 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 58550062-58558962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58556950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 400 (R400G)
Ref Sequence ENSEMBL: ENSMUSP00000153675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042450] [ENSMUST00000224479] [ENSMUST00000225815] [ENSMUST00000225828]
AlphaFold Q9D4G9
Predicted Effect probably benign
Transcript: ENSMUST00000042450
AA Change: R400G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000041035
Gene: ENSMUSG00000035367
AA Change: R400G

DomainStartEndE-ValueType
DUF1767 11 104 1.62e-34 SMART
low complexity region 243 259 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:RMI1_C 479 614 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224479
AA Change: R400G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224758
Predicted Effect probably benign
Transcript: ENSMUST00000225815
AA Change: R400G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000225828
AA Change: R400G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RMI1 is a component of protein complexes that limit DNA crossover formation via the dissolution of double Holliday junctions (Raynard et al., 2006 [PubMed 16595695]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased weight and increased resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,505,873 (GRCm39) T134A possibly damaging Het
Adamts18 C T 8: 114,499,800 (GRCm39) W371* probably null Het
Adgb C A 10: 10,278,748 (GRCm39) V267L probably benign Het
Akr1c13 G T 13: 4,247,869 (GRCm39) V214F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd52 A G 10: 128,225,128 (GRCm39) H863R probably damaging Het
Ap3b1 A G 13: 94,619,734 (GRCm39) R766G unknown Het
Apol7c A G 15: 77,410,595 (GRCm39) F117S probably damaging Het
Bcr A T 10: 74,989,752 (GRCm39) E716V probably damaging Het
Borcs6 T C 11: 68,951,423 (GRCm39) L267P probably damaging Het
Ccdc184 A T 15: 98,066,638 (GRCm39) N148Y probably benign Het
Ccdc50 A G 16: 27,255,351 (GRCm39) K223R probably null Het
Cd2 T G 3: 101,194,747 (GRCm39) K114Q probably benign Het
Cdh19 T C 1: 110,859,981 (GRCm39) K167E probably benign Het
Cep131 T C 11: 119,961,658 (GRCm39) E558G probably damaging Het
Cmya5 A T 13: 93,200,059 (GRCm39) V3423E probably damaging Het
Cnot6l A G 5: 96,225,070 (GRCm39) V541A probably benign Het
Cntn5 A T 9: 9,704,809 (GRCm39) C663* probably null Het
Dnaaf4 A G 9: 72,871,453 (GRCm39) I238V probably benign Het
Dnah12 T C 14: 26,456,913 (GRCm39) I893T possibly damaging Het
Dop1a G A 9: 86,403,578 (GRCm39) V129M probably damaging Het
Exoc6b A G 6: 84,831,791 (GRCm39) probably benign Het
Ext2 A G 2: 93,533,545 (GRCm39) V671A probably benign Het
Fcamr T G 1: 130,730,999 (GRCm39) L28R probably damaging Het
Fer1l6 T C 15: 58,425,554 (GRCm39) I144T probably damaging Het
Frem1 A G 4: 82,907,343 (GRCm39) L839P probably damaging Het
Fscn2 A T 11: 120,258,169 (GRCm39) I364F probably benign Het
Gm10291 T C 3: 78,824,581 (GRCm39) noncoding transcript Het
Gm29125 T C 1: 80,362,676 (GRCm39) noncoding transcript Het
Grin2b T C 6: 135,710,823 (GRCm39) M908V probably damaging Het
Helz2 T C 2: 180,881,101 (GRCm39) E436G probably damaging Het
Hfe A T 13: 23,890,061 (GRCm39) C149* probably null Het
Hs1bp3 T C 12: 8,386,357 (GRCm39) V253A probably benign Het
Kat14 A G 2: 144,246,140 (GRCm39) probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnh3 T A 15: 99,124,253 (GRCm39) D47E probably damaging Het
Kcp A G 6: 29,482,813 (GRCm39) F1419L possibly damaging Het
Kera A G 10: 97,445,493 (GRCm39) N284S probably benign Het
Klhl24 A G 16: 19,938,873 (GRCm39) D476G probably damaging Het
Krt79 T A 15: 101,848,241 (GRCm39) T137S possibly damaging Het
Lilrb4a A G 10: 51,367,584 (GRCm39) Y42C probably damaging Het
Lnx1 C T 5: 74,821,121 (GRCm39) probably benign Het
Map3k14 A G 11: 103,121,927 (GRCm39) Y497H probably damaging Het
Mmut G A 17: 41,257,946 (GRCm39) E371K probably damaging Het
Nkx2-6 A G 14: 69,412,375 (GRCm39) Q181R probably damaging Het
Notch1 T C 2: 26,368,093 (GRCm39) K631R possibly damaging Het
Or5an10 C T 19: 12,276,347 (GRCm39) V50I probably benign Het
Pcdh9 T A 14: 94,123,845 (GRCm39) N775I probably damaging Het
Phkb T A 8: 86,575,341 (GRCm39) probably benign Het
Pick1 T A 15: 79,130,666 (GRCm39) I250N probably damaging Het
Plec T C 15: 76,059,335 (GRCm39) E3556G probably damaging Het
Prex2 C T 1: 11,359,489 (GRCm39) Q1566* probably null Het
Ptgr2 T G 12: 84,355,128 (GRCm39) F287L possibly damaging Het
Ptprv T C 1: 135,051,869 (GRCm39) noncoding transcript Het
Rab5b G T 10: 128,519,130 (GRCm39) H83Q probably benign Het
Ranbp6 A T 19: 29,788,263 (GRCm39) Y696* probably null Het
Rapgef3 G T 15: 97,656,810 (GRCm39) D318E probably damaging Het
Rsrc1 T C 3: 67,257,311 (GRCm39) V241A probably damaging Het
Ryr2 A T 13: 12,121,301 (GRCm39) I11N possibly damaging Het
S100a11 T C 3: 93,433,321 (GRCm39) L55P probably damaging Het
Sec13 A G 6: 113,706,652 (GRCm39) S254P probably benign Het
Slc25a36 G A 9: 96,961,178 (GRCm39) T147I probably damaging Het
Spata31d1c A G 13: 65,184,411 (GRCm39) E651G probably benign Het
Stox2 C A 8: 47,646,851 (GRCm39) R203L probably damaging Het
Tbc1d30 A T 10: 121,132,691 (GRCm39) D224E probably damaging Het
Tdrd6 A G 17: 43,936,881 (GRCm39) L1389P probably damaging Het
Tmprss11b T C 5: 86,812,895 (GRCm39) S134G probably benign Het
Tmtc2 A T 10: 105,139,511 (GRCm39) S672T probably benign Het
Tnnt1 G A 7: 4,515,267 (GRCm39) probably benign Het
Tpst2 A G 5: 112,456,162 (GRCm39) M234V probably damaging Het
Ttbk2 T C 2: 120,603,804 (GRCm39) D208G probably benign Het
Ube2c A G 2: 164,614,093 (GRCm39) N143S possibly damaging Het
Unc45b T A 11: 82,816,835 (GRCm39) M425K probably benign Het
Uvssa G A 5: 33,547,300 (GRCm39) E289K possibly damaging Het
Vmn2r11 T A 5: 109,200,101 (GRCm39) R451W probably damaging Het
Vmn2r45 T C 7: 8,484,341 (GRCm39) Y488C probably damaging Het
Vmn2r55 T A 7: 12,404,627 (GRCm39) I259F possibly damaging Het
Wdfy3 C T 5: 102,031,949 (GRCm39) R2277Q possibly damaging Het
Wdr64 T G 1: 175,599,829 (GRCm39) M111R probably benign Het
Other mutations in Rmi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rmi1 APN 13 58,557,208 (GRCm39) missense probably damaging 1.00
IGL02304:Rmi1 APN 13 58,557,290 (GRCm39) nonsense probably null
R2046:Rmi1 UTSW 13 58,555,772 (GRCm39) missense probably benign
R2144:Rmi1 UTSW 13 58,555,797 (GRCm39) missense probably damaging 0.99
R4625:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4626:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4627:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4628:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R4629:Rmi1 UTSW 13 58,556,950 (GRCm39) missense probably benign 0.03
R5288:Rmi1 UTSW 13 58,557,280 (GRCm39) missense probably damaging 1.00
R6939:Rmi1 UTSW 13 58,557,169 (GRCm39) missense probably benign
R7337:Rmi1 UTSW 13 58,557,393 (GRCm39) nonsense probably null
R7741:Rmi1 UTSW 13 58,557,067 (GRCm39) missense probably benign
R8871:Rmi1 UTSW 13 58,557,156 (GRCm39) missense probably benign 0.04
R9248:Rmi1 UTSW 13 58,556,899 (GRCm39) missense probably benign 0.04
R9268:Rmi1 UTSW 13 58,555,853 (GRCm39) missense probably damaging 0.99
R9269:Rmi1 UTSW 13 58,556,840 (GRCm39) missense probably benign 0.12
R9627:Rmi1 UTSW 13 58,557,366 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTTTTGGAAGAGACTGTCC -3'
(R):5'- TGGAAAGGGTGGCCATTTTC -3'

Sequencing Primer
(F):5'- TCGCAGCCACTAACTTTGAAGG -3'
(R):5'- AAAGGGTGGCCATTTTCTTTAG -3'
Posted On 2015-09-25