Mutagenetix > Incidental Mutation

Incidental Mutation 'R4624:Ap3b1'

346444

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

041889-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R4624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94483226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 766 (R766G)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

unknown
Transcript: ENSMUST00000022196
AA Change: R766G

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R766G

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

unknown
Transcript: ENSMUST00000231916
AA Change: R131G

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

93% (85/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730409E04Rik	A	G	4: 126,612,080	T134A	possibly damaging	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adgb	C	A	10: 10,403,004	V267L	probably benign	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd52	A	G	10: 128,389,259	H863R	probably damaging	Het
Apol7c	A	G	15: 77,526,395	F117S	probably damaging	Het
Bcr	A	T	10: 75,153,920	E716V	probably damaging	Het
Borcs6	T	C	11: 69,060,597	L267P	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Ccdc50	A	G	16: 27,436,601	K223R	probably null	Het
Cd2	T	G	3: 101,287,431	K114Q	probably benign	Het
Cdh19	T	C	1: 110,932,251	K167E	probably benign	Het
Cep131	T	C	11: 120,070,832	E558G	probably damaging	Het
Cmya5	A	T	13: 93,063,551	V3423E	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cntn5	A	T	9: 9,704,804	C663*	probably null	Het
Dnah12	T	C	14: 26,735,758	I893T	possibly damaging	Het
Dopey1	G	A	9: 86,521,525	V129M	probably damaging	Het
Dyx1c1	A	G	9: 72,964,171	I238V	probably benign	Het
Exoc6b	A	G	6: 84,854,809		probably benign	Het
Ext2	A	G	2: 93,703,200	V671A	probably benign	Het
Fcamr	T	G	1: 130,803,262	L28R	probably damaging	Het
Fer1l6	T	C	15: 58,553,705	I144T	probably damaging	Het
Frem1	A	G	4: 82,989,106	L839P	probably damaging	Het
Fscn2	A	T	11: 120,367,343	I364F	probably benign	Het
Gm10291	T	C	3: 78,917,274		noncoding transcript	Het
Gm29125	T	C	1: 80,384,959		noncoding transcript	Het
Grin2b	T	C	6: 135,733,825	M908V	probably damaging	Het
Helz2	T	C	2: 181,239,308	E436G	probably damaging	Het
Hfe	A	T	13: 23,706,078	C149*	probably null	Het
Hs1bp3	T	C	12: 8,336,357	V253A	probably benign	Het
Kat14	A	G	2: 144,404,220		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnh3	T	A	15: 99,226,372	D47E	probably damaging	Het
Kcp	A	G	6: 29,482,814	F1419L	possibly damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Klhl24	A	G	16: 20,120,123	D476G	probably damaging	Het
Krt79	T	A	15: 101,939,806	T137S	possibly damaging	Het
Lilrb4a	A	G	10: 51,491,488	Y42C	probably damaging	Het
Lnx1	C	T	5: 74,660,460		probably benign	Het
Map3k14	A	G	11: 103,231,101	Y497H	probably damaging	Het
Mut	G	A	17: 40,947,055	E371K	probably damaging	Het
Nkx2-6	A	G	14: 69,174,926	Q181R	probably damaging	Het
Notch1	T	C	2: 26,478,081	K631R	possibly damaging	Het
Olfr1436	C	T	19: 12,298,983	V50I	probably benign	Het
Pcdh9	T	A	14: 93,886,409	N775I	probably damaging	Het
Phkb	T	A	8: 85,848,712		probably benign	Het
Pick1	T	A	15: 79,246,466	I250N	probably damaging	Het
Plec	T	C	15: 76,175,135	E3556G	probably damaging	Het
Prex2	C	T	1: 11,289,265	Q1566*	probably null	Het
Ptgr2	T	G	12: 84,308,354	F287L	possibly damaging	Het
Ptprv	T	C	1: 135,124,131		noncoding transcript	Het
Rab5b	G	T	10: 128,683,261	H83Q	probably benign	Het
Ranbp6	A	T	19: 29,810,863	Y696*	probably null	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Rsrc1	T	C	3: 67,349,978	V241A	probably damaging	Het
Ryr2	A	T	13: 12,106,415	I11N	possibly damaging	Het
S100a11	T	C	3: 93,526,014	L55P	probably damaging	Het
Sec13	A	G	6: 113,729,691	S254P	probably benign	Het
Slc25a36	G	A	9: 97,079,125	T147I	probably damaging	Het
Spata31d1c	A	G	13: 65,036,597	E651G	probably benign	Het
Stox2	C	A	8: 47,193,816	R203L	probably damaging	Het
Tbc1d30	A	T	10: 121,296,786	D224E	probably damaging	Het
Tdrd6	A	G	17: 43,625,990	L1389P	probably damaging	Het
Tmprss11b	T	C	5: 86,665,036	S134G	probably benign	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Tnnt1	G	A	7: 4,512,268		probably benign	Het
Tpst2	A	G	5: 112,308,296	M234V	probably damaging	Het
Ttbk2	T	C	2: 120,773,323	D208G	probably benign	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Unc45b	T	A	11: 82,926,009	M425K	probably benign	Het
Uvssa	G	A	5: 33,389,956	E289K	possibly damaging	Het
Vmn2r11	T	A	5: 109,052,235	R451W	probably damaging	Het
Vmn2r45	T	C	7: 8,481,342	Y488C	probably damaging	Het
Vmn2r55	T	A	7: 12,670,700	I259F	possibly damaging	Het
Wdfy3	C	T	5: 101,884,083	R2277Q	possibly damaging	Het
Wdr64	T	G	1: 175,772,263	M111R	probably benign	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTCAGGATCAGAGAGCC -3'
(R):5'- ATGTACGTCAGCACAGCAC -3'

Sequencing Primer
(F):5'- GAAGATCAGACTGTGCTTGTCATTC -3'
(R):5'- ACATGCATGGTCTTACCGGAG -3'

Posted On

2015-09-25