Mutagenetix > Incidental Mutations

Incidental Mutation 'R4624:Krt79'

346455

Institutional Source

Beutler Lab

Gene Symbol

Krt79

Ensembl Gene

ENSMUSG00000061397

Gene Name

keratin 79

Synonyms

MMRRC Submission

041889-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4624 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101929332-101940324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101939806 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 137 (T137S)

Ref Sequence

ENSEMBL: ENSMUSP00000023799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023799]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023799
AA Change: T137S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: T137S

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	15	98	6.6e-11	PFAM
Pfam:Keratin_2_head	73	135	1.2e-21	PFAM
Filament	138	452	7.12e-159	SMART
low complexity region	474	500	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229195

Meta Mutation Damage Score

0.1051

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

93% (85/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730409E04Rik	A	G	4: 126,612,080	T134A	possibly damaging	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adgb	C	A	10: 10,403,004	V267L	probably benign	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd52	A	G	10: 128,389,259	H863R	probably damaging	Het
Ap3b1	A	G	13: 94,483,226	R766G	unknown	Het
Apol7c	A	G	15: 77,526,395	F117S	probably damaging	Het
Bcr	A	T	10: 75,153,920	E716V	probably damaging	Het
Borcs6	T	C	11: 69,060,597	L267P	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Ccdc50	A	G	16: 27,436,601	K223R	probably null	Het
Cd2	T	G	3: 101,287,431	K114Q	probably benign	Het
Cdh19	T	C	1: 110,932,251	K167E	probably benign	Het
Cep131	T	C	11: 120,070,832	E558G	probably damaging	Het
Cmya5	A	T	13: 93,063,551	V3423E	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cntn5	A	T	9: 9,704,804	C663*	probably null	Het
Dnah12	T	C	14: 26,735,758	I893T	possibly damaging	Het
Dopey1	G	A	9: 86,521,525	V129M	probably damaging	Het
Dyx1c1	A	G	9: 72,964,171	I238V	probably benign	Het
Exoc6b	A	G	6: 84,854,809		probably benign	Het
Ext2	A	G	2: 93,703,200	V671A	probably benign	Het
Fcamr	T	G	1: 130,803,262	L28R	probably damaging	Het
Fer1l6	T	C	15: 58,553,705	I144T	probably damaging	Het
Frem1	A	G	4: 82,989,106	L839P	probably damaging	Het
Fscn2	A	T	11: 120,367,343	I364F	probably benign	Het
Gm10291	T	C	3: 78,917,274		noncoding transcript	Het
Gm29125	T	C	1: 80,384,959		noncoding transcript	Het
Grin2b	T	C	6: 135,733,825	M908V	probably damaging	Het
Helz2	T	C	2: 181,239,308	E436G	probably damaging	Het
Hfe	A	T	13: 23,706,078	C149*	probably null	Het
Hs1bp3	T	C	12: 8,336,357	V253A	probably benign	Het
Kat14	A	G	2: 144,404,220		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnh3	T	A	15: 99,226,372	D47E	probably damaging	Het
Kcp	A	G	6: 29,482,814	F1419L	possibly damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Klhl24	A	G	16: 20,120,123	D476G	probably damaging	Het
Lilrb4a	A	G	10: 51,491,488	Y42C	probably damaging	Het
Lnx1	C	T	5: 74,660,460		probably benign	Het
Map3k14	A	G	11: 103,231,101	Y497H	probably damaging	Het
Mut	G	A	17: 40,947,055	E371K	probably damaging	Het
Nkx2-6	A	G	14: 69,174,926	Q181R	probably damaging	Het
Notch1	T	C	2: 26,478,081	K631R	possibly damaging	Het
Olfr1436	C	T	19: 12,298,983	V50I	probably benign	Het
Pcdh9	T	A	14: 93,886,409	N775I	probably damaging	Het
Phkb	T	A	8: 85,848,712		probably benign	Het
Pick1	T	A	15: 79,246,466	I250N	probably damaging	Het
Plec	T	C	15: 76,175,135	E3556G	probably damaging	Het
Prex2	C	T	1: 11,289,265	Q1566*	probably null	Het
Ptgr2	T	G	12: 84,308,354	F287L	possibly damaging	Het
Ptprv	T	C	1: 135,124,131		noncoding transcript	Het
Rab5b	G	T	10: 128,683,261	H83Q	probably benign	Het
Ranbp6	A	T	19: 29,810,863	Y696*	probably null	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Rsrc1	T	C	3: 67,349,978	V241A	probably damaging	Het
Ryr2	A	T	13: 12,106,415	I11N	possibly damaging	Het
S100a11	T	C	3: 93,526,014	L55P	probably damaging	Het
Sec13	A	G	6: 113,729,691	S254P	probably benign	Het
Slc25a36	G	A	9: 97,079,125	T147I	probably damaging	Het
Spata31d1c	A	G	13: 65,036,597	E651G	probably benign	Het
Stox2	C	A	8: 47,193,816	R203L	probably damaging	Het
Tbc1d30	A	T	10: 121,296,786	D224E	probably damaging	Het
Tdrd6	A	G	17: 43,625,990	L1389P	probably damaging	Het
Tmprss11b	T	C	5: 86,665,036	S134G	probably benign	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Tnnt1	G	A	7: 4,512,268		probably benign	Het
Tpst2	A	G	5: 112,308,296	M234V	probably damaging	Het
Ttbk2	T	C	2: 120,773,323	D208G	probably benign	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Unc45b	T	A	11: 82,926,009	M425K	probably benign	Het
Uvssa	G	A	5: 33,389,956	E289K	possibly damaging	Het
Vmn2r11	T	A	5: 109,052,235	R451W	probably damaging	Het
Vmn2r45	T	C	7: 8,481,342	Y488C	probably damaging	Het
Vmn2r55	T	A	7: 12,670,700	I259F	possibly damaging	Het
Wdfy3	C	T	5: 101,884,083	R2277Q	possibly damaging	Het
Wdr64	T	G	1: 175,772,263	M111R	probably benign	Het

Other mutations in Krt79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Krt79	APN	15	101940166	missense	probably damaging	0.98
IGL00546:Krt79	APN	15	101929873	missense	probably benign	0.00
IGL01595:Krt79	APN	15	101931771	missense	probably damaging	0.98
IGL02193:Krt79	APN	15	101939905	missense	possibly damaging	0.59
R0639:Krt79	UTSW	15	101931548	nonsense	probably null
R0980:Krt79	UTSW	15	101938007	missense	probably damaging	1.00
R1839:Krt79	UTSW	15	101937938	missense	possibly damaging	0.81
R4745:Krt79	UTSW	15	101930684	missense	probably damaging	1.00
R5203:Krt79	UTSW	15	101929740	missense	unknown
R5382:Krt79	UTSW	15	101931440	missense	probably benign	0.09
R5568:Krt79	UTSW	15	101929785	missense	probably damaging	0.99
R6902:Krt79	UTSW	15	101931879	missense	probably benign	0.08
R6916:Krt79	UTSW	15	101936170	missense	probably benign	0.01
R6998:Krt79	UTSW	15	101937872	missense	probably benign
R7009:Krt79	UTSW	15	101931441	missense	probably damaging	1.00
R7663:Krt79	UTSW	15	101931843	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAGAAACCACCGTCTCTGTTC -3'
(R):5'- GAATATCTCCGTCAGCATGGC -3'

Sequencing Primer
(F):5'- GAAACCACCGTCTCTGTTCATCAC -3'
(R):5'- CTCCGTCAGCATGGCTTGTG -3'

Posted On

2015-09-25