Incidental Mutation 'R4624:Olfr1436'
ID346460
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission 041889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4624 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12298983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 50 (V50I)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably benign
Transcript: ENSMUST00000087812
AA Change: V50I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: V50I

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 93% (85/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik A G 4: 126,612,080 T134A possibly damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Adgb C A 10: 10,403,004 V267L probably benign Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd52 A G 10: 128,389,259 H863R probably damaging Het
Ap3b1 A G 13: 94,483,226 R766G unknown Het
Apol7c A G 15: 77,526,395 F117S probably damaging Het
Bcr A T 10: 75,153,920 E716V probably damaging Het
Borcs6 T C 11: 69,060,597 L267P probably damaging Het
Ccdc184 A T 15: 98,168,757 N148Y probably benign Het
Ccdc50 A G 16: 27,436,601 K223R probably null Het
Cd2 T G 3: 101,287,431 K114Q probably benign Het
Cdh19 T C 1: 110,932,251 K167E probably benign Het
Cep131 T C 11: 120,070,832 E558G probably damaging Het
Cmya5 A T 13: 93,063,551 V3423E probably damaging Het
Cnot6l A G 5: 96,077,211 V541A probably benign Het
Cntn5 A T 9: 9,704,804 C663* probably null Het
Dnah12 T C 14: 26,735,758 I893T possibly damaging Het
Dopey1 G A 9: 86,521,525 V129M probably damaging Het
Dyx1c1 A G 9: 72,964,171 I238V probably benign Het
Exoc6b A G 6: 84,854,809 probably benign Het
Ext2 A G 2: 93,703,200 V671A probably benign Het
Fcamr T G 1: 130,803,262 L28R probably damaging Het
Fer1l6 T C 15: 58,553,705 I144T probably damaging Het
Frem1 A G 4: 82,989,106 L839P probably damaging Het
Fscn2 A T 11: 120,367,343 I364F probably benign Het
Gm10291 T C 3: 78,917,274 noncoding transcript Het
Gm29125 T C 1: 80,384,959 noncoding transcript Het
Grin2b T C 6: 135,733,825 M908V probably damaging Het
Helz2 T C 2: 181,239,308 E436G probably damaging Het
Hfe A T 13: 23,706,078 C149* probably null Het
Hs1bp3 T C 12: 8,336,357 V253A probably benign Het
Kat14 A G 2: 144,404,220 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnh3 T A 15: 99,226,372 D47E probably damaging Het
Kcp A G 6: 29,482,814 F1419L possibly damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Klhl24 A G 16: 20,120,123 D476G probably damaging Het
Krt79 T A 15: 101,939,806 T137S possibly damaging Het
Lilrb4a A G 10: 51,491,488 Y42C probably damaging Het
Lnx1 C T 5: 74,660,460 probably benign Het
Map3k14 A G 11: 103,231,101 Y497H probably damaging Het
Mut G A 17: 40,947,055 E371K probably damaging Het
Nkx2-6 A G 14: 69,174,926 Q181R probably damaging Het
Notch1 T C 2: 26,478,081 K631R possibly damaging Het
Pcdh9 T A 14: 93,886,409 N775I probably damaging Het
Phkb T A 8: 85,848,712 probably benign Het
Pick1 T A 15: 79,246,466 I250N probably damaging Het
Plec T C 15: 76,175,135 E3556G probably damaging Het
Prex2 C T 1: 11,289,265 Q1566* probably null Het
Ptgr2 T G 12: 84,308,354 F287L possibly damaging Het
Ptprv T C 1: 135,124,131 noncoding transcript Het
Rab5b G T 10: 128,683,261 H83Q probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rapgef3 G T 15: 97,758,929 D318E probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Rsrc1 T C 3: 67,349,978 V241A probably damaging Het
Ryr2 A T 13: 12,106,415 I11N possibly damaging Het
S100a11 T C 3: 93,526,014 L55P probably damaging Het
Sec13 A G 6: 113,729,691 S254P probably benign Het
Slc25a36 G A 9: 97,079,125 T147I probably damaging Het
Spata31d1c A G 13: 65,036,597 E651G probably benign Het
Stox2 C A 8: 47,193,816 R203L probably damaging Het
Tbc1d30 A T 10: 121,296,786 D224E probably damaging Het
Tdrd6 A G 17: 43,625,990 L1389P probably damaging Het
Tmprss11b T C 5: 86,665,036 S134G probably benign Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tnnt1 G A 7: 4,512,268 probably benign Het
Tpst2 A G 5: 112,308,296 M234V probably damaging Het
Ttbk2 T C 2: 120,773,323 D208G probably benign Het
Ube2c A G 2: 164,772,173 N143S possibly damaging Het
Unc45b T A 11: 82,926,009 M425K probably benign Het
Uvssa G A 5: 33,389,956 E289K possibly damaging Het
Vmn2r11 T A 5: 109,052,235 R451W probably damaging Het
Vmn2r45 T C 7: 8,481,342 Y488C probably damaging Het
Vmn2r55 T A 7: 12,670,700 I259F possibly damaging Het
Wdfy3 C T 5: 101,884,083 R2277Q possibly damaging Het
Wdr64 T G 1: 175,772,263 M111R probably benign Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1837:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R5983:Olfr1436 UTSW 19 12299103 missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12298437 missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12298632 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGATTCACTCAGTCCC -3'
(R):5'- GTTCCCTTGAACCAATGATGTTTTC -3'

Sequencing Primer
(F):5'- AAGATTCACTCAGTCCCATTGTGG -3'
(R):5'- GAACCAATGATGTTTTCTTTTTCTCC -3'
Posted On2015-09-25