Incidental Mutation 'R4625:Astn1'
ID346466
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Nameastrotactin 1
Synonyms
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location158362273-158691781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158580294 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 607 (D607V)
Ref Sequence ENSEMBL: ENSMUSP00000039711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]
Predicted Effect probably damaging
Transcript: ENSMUST00000046110
AA Change: D607V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: D607V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170718
AA Change: D615V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: D615V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000193042
AA Change: D615V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: D615V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193599
AA Change: D105V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587
AA Change: D105V

DomainStartEndE-ValueType
EGF 101 142 1.1e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194369
AA Change: D607V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: D607V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000195311
AA Change: D607V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: D607V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Meta Mutation Damage Score 0.6866 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
PIT4366001:Astn1 UTSW 1 158597211 missense probably benign 0.23
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158502353 missense probably damaging 1.00
R1517:Astn1 UTSW 1 158579576 splice site probably benign
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 splice site probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 splice site probably null
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6020:Astn1 UTSW 1 158509993 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7062:Astn1 UTSW 1 158688511 critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 splice site probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7487:Astn1 UTSW 1 158610782 splice site probably null
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
R7890:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7894:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7904:Astn1 UTSW 1 158597316 missense probably benign 0.37
R8048:Astn1 UTSW 1 158688638 missense probably benign 0.00
R8061:Astn1 UTSW 1 158504350 critical splice donor site probably null
R8096:Astn1 UTSW 1 158609320 missense probably damaging 1.00
R8327:Astn1 UTSW 1 158609280 missense probably damaging 1.00
R8374:Astn1 UTSW 1 158502233 missense probably damaging 1.00
R8400:Astn1 UTSW 1 158657100 missense probably benign 0.09
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAATGCCCATGATTTGTTAGTTC -3'
(R):5'- TCACAGCTGGCTACTACACG -3'

Sequencing Primer
(F):5'- GCCCATGATTTGTTAGTTCAACAC -3'
(R):5'- ACAGCTGGCTACTACACGGATTTG -3'
Posted On2015-09-25