Incidental Mutation 'R4625:Chd6'
ID346469
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160969492 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1397 (L1397P)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: L1397P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: L1397P

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137152
Meta Mutation Damage Score 0.6668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense not run
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGCTTTCTTGCCCCGAC -3'
(R):5'- CAAAATTGTTGCCTTTCCCACTAG -3'

Sequencing Primer
(F):5'- CTTGCCCCGACTGTTACC -3'
(R):5'- GCTCCTGACTGATGTTAAAGCAGC -3'
Posted On2015-09-25