Incidental Mutation 'R4625:Tshb'
ID346473
Institutional Source Beutler Lab
Gene Symbol Tshb
Ensembl Gene ENSMUSG00000027857
Gene Namethyroid stimulating hormone, beta subunit
Synonymsthyrotropin
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102775465-102782718 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 102778145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029450] [ENSMUST00000170856] [ENSMUST00000172026] [ENSMUST00000197322] [ENSMUST00000197345] [ENSMUST00000200041]
Predicted Effect probably null
Transcript: ENSMUST00000029450
SMART Domains Protein: ENSMUSP00000029450
Gene: ENSMUSG00000027857

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
GHB 18 126 5.13e-63 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170856
SMART Domains Protein: ENSMUSP00000127165
Gene: ENSMUSG00000027857

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
GHB 18 126 5.13e-63 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172026
SMART Domains Protein: ENSMUSP00000128440
Gene: ENSMUSG00000027857

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
GHB 18 126 5.13e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196958
Predicted Effect probably null
Transcript: ENSMUST00000197322
SMART Domains Protein: ENSMUSP00000142670
Gene: ENSMUSG00000027857

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
GHB 18 126 5.13e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197345
SMART Domains Protein: ENSMUSP00000142543
Gene: ENSMUSG00000027858

DomainStartEndE-ValueType
Pfam:Tetraspannin 3 87 1.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200041
SMART Domains Protein: ENSMUSP00000142782
Gene: ENSMUSG00000027857

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
GHB 18 126 5.13e-63 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Tshb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03193:Tshb APN 3 102778199 missense probably damaging 1.00
PIT4458001:Tshb UTSW 3 102778164 missense probably damaging 1.00
R1499:Tshb UTSW 3 102778308 intron probably benign
R1945:Tshb UTSW 3 102777515 nonsense probably null
R2051:Tshb UTSW 3 102777541 missense probably benign 0.00
R2135:Tshb UTSW 3 102778148 critical splice donor site probably null
R4754:Tshb UTSW 3 102778175 missense probably damaging 1.00
R5589:Tshb UTSW 3 102778162 nonsense probably null
Z1177:Tshb UTSW 3 102778173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTACAAATGCACCTGTACTTTC -3'
(R):5'- TGCACAGACATGCCTCTGAG -3'

Sequencing Primer
(F):5'- CCTTTCTGAGTAGAGTCACACC -3'
(R):5'- GAGGACACTGTACTGAGCTC -3'
Posted On2015-09-25