Mutagenetix > Incidental Mutations

Incidental Mutation 'R4625:Smarca5'

346492

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

041890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4625 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80710563 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 721 (K721N)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: K721N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: K721N

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150277

Meta Mutation Damage Score

0.1150

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	C	5: 145,044,883	E176A	possibly damaging	Het
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
4933417A18Rik	G	A	13: 34,932,465	G66S	probably damaging	Het
5830473C10Rik	G	T	5: 90,571,752	V236L	probably damaging	Het
Abcc2	A	G	19: 43,803,739	I320V	probably benign	Het
Abtb1	C	T	6: 88,836,287	A466T	probably benign	Het
Ak6	C	A	13: 100,655,673	T208K	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Anapc15	T	A	7: 101,901,032		probably benign	Het
Aspn	A	G	13: 49,557,425	D182G	probably benign	Het
Astn1	A	T	1: 158,580,294	D607V	probably damaging	Het
Btnl1	A	G	17: 34,379,751	I114V	probably null	Het
Ccdc159	A	G	9: 21,929,466	S110G	probably benign	Het
Ccdc94	T	A	17: 55,964,598	L173Q	probably damaging	Het
Cdh18	A	C	15: 22,714,042		probably benign	Het
Cdh22	A	G	2: 165,112,606	I665T	probably damaging	Het
Cenpk	T	A	13: 104,249,393	H265Q	possibly damaging	Het
Chd6	A	G	2: 160,969,492	L1397P	probably damaging	Het
Chia1	A	C	3: 106,128,940	N279H	probably benign	Het
Cyp8b1	T	C	9: 121,915,585	E227G	probably damaging	Het
Dmxl2	A	T	9: 54,404,120	N1772K	possibly damaging	Het
Dnah2	A	G	11: 69,463,661	S2244P	probably damaging	Het
Fshr	T	C	17: 88,985,720	Y510C	probably damaging	Het
Gm21188	G	T	13: 120,035,229	R35S	possibly damaging	Het
Gm5087	T	C	14: 13,158,798		noncoding transcript	Het
Gm7135	A	C	1: 97,459,626		noncoding transcript	Het
Hnrnpll	A	T	17: 80,050,862	Y153*	probably null	Het
Htt	T	A	5: 34,829,785	V1116E	probably damaging	Het
Ikzf5	A	T	7: 131,393,753		probably null	Het
Kcnb1	A	G	2: 167,188,233	S131P	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kctd21	A	G	7: 97,347,575	D85G	probably damaging	Het
Kera	A	G	10: 97,609,631	N284S	probably benign	Het
Kif1a	A	T	1: 93,042,659	D952E	probably benign	Het
Klf4	A	G	4: 55,530,370	V247A	probably benign	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Lamc1	A	G	1: 153,242,696	S910P	probably benign	Het
Lin9	T	A	1: 180,689,280	N512K	probably damaging	Het
Mettl7a1	A	T	15: 100,313,058	Q170L	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Mrps30	A	G	13: 118,386,714	V174A	probably benign	Het
Myo1g	T	C	11: 6,512,240	E574G	probably damaging	Het
Nphp3	G	A	9: 104,036,159	G997R	possibly damaging	Het
Obscn	A	G	11: 59,067,258	C3748R	probably damaging	Het
Olfr346	A	G	2: 36,688,071	D23G	probably benign	Het
Olfr466	T	A	13: 65,152,860	V212D	possibly damaging	Het
Olfr494	T	C	7: 108,367,688	L66P	probably damaging	Het
Olfr945	A	T	9: 39,258,318	M118K	probably damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Ptch1	T	C	13: 63,523,164	T851A	probably benign	Het
Ranbp6	A	T	19: 29,810,863	Y696*	probably null	Het
Rbp3	A	G	14: 33,956,099	Q668R	probably benign	Het
Rfwd3	T	C	8: 111,276,358	T611A	probably benign	Het
Rhcg	T	A	7: 79,601,604	D219V	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Slc25a26	G	T	6: 94,507,652	V58F	probably damaging	Het
Sp110	A	C	1: 85,577,329	F434C	probably benign	Het
Speer2	A	T	16: 69,858,754	Y61*	probably null	Het
Spef2	T	C	15: 9,647,438	Y961C	probably damaging	Het
Sptb	C	A	12: 76,587,326		probably null	Het
Svep1	T	G	4: 58,072,698	N2204H	probably damaging	Het
Tmem86a	C	A	7: 47,052,865	P13T	probably damaging	Het
Tmtc2	A	T	10: 105,303,650	S672T	probably benign	Het
Tox2	G	A	2: 163,314,416	S211N	possibly damaging	Het
Trpc6	A	T	9: 8,677,962	E762D	probably benign	Het
Tshb	C	T	3: 102,778,145		probably null	Het
Ttc3	T	A	16: 94,388,272	L163*	probably null	Het
Twsg1	G	T	17: 65,929,551	D161E	probably benign	Het
Uchl4	A	C	9: 64,235,798	D187A	probably damaging	Het
Vmn2r104	A	T	17: 20,048,181	W9R	probably benign	Het
Zfp14	G	A	7: 30,038,595	Q322*	probably null	Het
Znhit3	G	A	11: 84,911,490	P145S	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACCCAGGGCCATATTAAG -3'
(R):5'- CCTCCTATAGTCCAGGCTGATG -3'

Sequencing Primer
(F):5'- ACCCAGGGCCATATTAAGATATC -3'
(R):5'- CTTTACGATGGACACAGAG -3'

Posted On

2015-09-25