Incidental Mutation 'R4625:Uchl4'
ID346498
Institutional Source Beutler Lab
Gene Symbol Uchl4
Ensembl Gene ENSMUSG00000035337
Gene Nameubiquitin carboxyl-terminal esterase L4
Synonyms
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64235201-64236362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64235798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 187 (D187A)
Ref Sequence ENSEMBL: ENSMUSP00000045208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066] [ENSMUST00000039011]
Predicted Effect probably benign
Transcript: ENSMUST00000005066
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039011
AA Change: D187A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045208
Gene: ENSMUSG00000035337
AA Change: D187A

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 217 2.2e-65 PFAM
Meta Mutation Damage Score 0.9732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype Homozygous inactivation of this gene leads to reduced embryo size and midgestational lethality due to impaired development and hypovascularization of the placenta with decreased labyrinth cell proliferation and enhanced cell apoptosis. Mutant MEFs fail to exhibit fibronectin-induced migration.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Uchl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Uchl4 APN 9 64235716 missense possibly damaging 0.82
IGL01710:Uchl4 APN 9 64235506 missense probably benign 0.20
IGL02030:Uchl4 APN 9 64235629 missense probably benign
IGL02739:Uchl4 APN 9 64235537 missense probably damaging 1.00
R0026:Uchl4 UTSW 9 64235371 intron probably null
R0026:Uchl4 UTSW 9 64235371 intron probably null
R1572:Uchl4 UTSW 9 64235731 missense probably benign
R1801:Uchl4 UTSW 9 64235475 missense probably benign
R2113:Uchl4 UTSW 9 64235536 missense probably damaging 1.00
R4042:Uchl4 UTSW 9 64235557 missense probably benign 0.00
R4500:Uchl4 UTSW 9 64235881 missense possibly damaging 0.96
R5176:Uchl4 UTSW 9 64235740 nonsense probably null
R5364:Uchl4 UTSW 9 64235539 missense possibly damaging 0.88
R6581:Uchl4 UTSW 9 64235793 missense possibly damaging 0.93
R7134:Uchl4 UTSW 9 64235339 missense probably damaging 1.00
R7451:Uchl4 UTSW 9 64235731 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTATCAATGAGCCCTGAAG -3'
(R):5'- TTCAGGAAAGACCGGGCTTC -3'

Sequencing Primer
(F):5'- CCTGAAGAGAGAGCCAAATACCTG -3'
(R):5'- TCTAGAACTTGGAGAGCCACCTG -3'
Posted On2015-09-25