Incidental Mutation 'R4625:Tmtc2'
ID346502
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105303650 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 672 (S672T)
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably benign
Transcript: ENSMUST00000061506
AA Change: S672T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019
AA Change: S672T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143691
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4280:Tmtc2 UTSW 10 105348433 critical splice donor site probably null
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4603:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5769:Tmtc2 UTSW 10 105370046 missense probably benign 0.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5892:Tmtc2 UTSW 10 105413505 missense probably benign 0.08
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
R7576:Tmtc2 UTSW 10 105370621 missense probably damaging 1.00
R7728:Tmtc2 UTSW 10 105271497 critical splice donor site probably null
R7850:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
R8024:Tmtc2 UTSW 10 105190126 missense probably benign 0.37
R8417:Tmtc2 UTSW 10 105413236 missense probably damaging 0.98
R8697:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R8913:Tmtc2 UTSW 10 105323026 missense probably damaging 1.00
Z1176:Tmtc2 UTSW 10 105303622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTTTAGGCCTCTAACAG -3'
(R):5'- CCAGGTGTATCTCCCTTATGGC -3'

Sequencing Primer
(F):5'- ACAGGATTGTTATCATTCATCAAGTG -3'
(R):5'- GATTCTCTCCTGATGAAATTTCCAG -3'
Posted On2015-09-25