Incidental Mutation 'R4625:Olfr466'
ID346513
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65152860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 212 (V212D)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058907
AA Change: V212D

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: V212D

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214214
AA Change: V212D

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4408:Olfr466 UTSW 13 65152700 missense probably benign 0.00
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5419:Olfr466 UTSW 13 65152774 missense probably damaging 1.00
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7292:Olfr466 UTSW 13 65152842 missense possibly damaging 0.94
R7345:Olfr466 UTSW 13 65152743 missense possibly damaging 0.59
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATGTCCCACTGGGTCTGTG -3'
(R):5'- CTTTGCTCTGCTCCATGGAG -3'

Sequencing Primer
(F):5'- GTGAATGCTGTCACGCAAAC -3'
(R):5'- TCCATGGAGGAGACAGCACTG -3'
Posted On2015-09-25