Incidental Mutation 'R4625:Krt1'
ID346522
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
MMRRC Submission 041890-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R4625 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101846187 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 543 (G543S)
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
Predicted Effect unknown
Transcript: ENSMUST00000023790
AA Change: G543S
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834
AA Change: G543S

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 145,044,883 E176A possibly damaging Het
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
4933417A18Rik G A 13: 34,932,465 G66S probably damaging Het
5830473C10Rik G T 5: 90,571,752 V236L probably damaging Het
Abcc2 A G 19: 43,803,739 I320V probably benign Het
Abtb1 C T 6: 88,836,287 A466T probably benign Het
Ak6 C A 13: 100,655,673 T208K probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anapc15 T A 7: 101,901,032 probably benign Het
Aspn A G 13: 49,557,425 D182G probably benign Het
Astn1 A T 1: 158,580,294 D607V probably damaging Het
Btnl1 A G 17: 34,379,751 I114V probably null Het
Ccdc159 A G 9: 21,929,466 S110G probably benign Het
Ccdc94 T A 17: 55,964,598 L173Q probably damaging Het
Cdh18 A C 15: 22,714,042 probably benign Het
Cdh22 A G 2: 165,112,606 I665T probably damaging Het
Cenpk T A 13: 104,249,393 H265Q possibly damaging Het
Chd6 A G 2: 160,969,492 L1397P probably damaging Het
Chia1 A C 3: 106,128,940 N279H probably benign Het
Cyp8b1 T C 9: 121,915,585 E227G probably damaging Het
Dmxl2 A T 9: 54,404,120 N1772K possibly damaging Het
Dnah2 A G 11: 69,463,661 S2244P probably damaging Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gm21188 G T 13: 120,035,229 R35S possibly damaging Het
Gm5087 T C 14: 13,158,798 noncoding transcript Het
Gm7135 A C 1: 97,459,626 noncoding transcript Het
Hnrnpll A T 17: 80,050,862 Y153* probably null Het
Htt T A 5: 34,829,785 V1116E probably damaging Het
Ikzf5 A T 7: 131,393,753 probably null Het
Kcnb1 A G 2: 167,188,233 S131P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Kera A G 10: 97,609,631 N284S probably benign Het
Kif1a A T 1: 93,042,659 D952E probably benign Het
Klf4 A G 4: 55,530,370 V247A probably benign Het
Lamc1 A G 1: 153,242,696 S910P probably benign Het
Lin9 T A 1: 180,689,280 N512K probably damaging Het
Mettl7a1 A T 15: 100,313,058 Q170L probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Mrps30 A G 13: 118,386,714 V174A probably benign Het
Myo1g T C 11: 6,512,240 E574G probably damaging Het
Nphp3 G A 9: 104,036,159 G997R possibly damaging Het
Obscn A G 11: 59,067,258 C3748R probably damaging Het
Olfr346 A G 2: 36,688,071 D23G probably benign Het
Olfr466 T A 13: 65,152,860 V212D possibly damaging Het
Olfr494 T C 7: 108,367,688 L66P probably damaging Het
Olfr945 A T 9: 39,258,318 M118K probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Ptch1 T C 13: 63,523,164 T851A probably benign Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rbp3 A G 14: 33,956,099 Q668R probably benign Het
Rfwd3 T C 8: 111,276,358 T611A probably benign Het
Rhcg T A 7: 79,601,604 D219V probably damaging Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Slc25a26 G T 6: 94,507,652 V58F probably damaging Het
Smarca5 T A 8: 80,710,563 K721N probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Speer2 A T 16: 69,858,754 Y61* probably null Het
Spef2 T C 15: 9,647,438 Y961C probably damaging Het
Sptb C A 12: 76,587,326 probably null Het
Svep1 T G 4: 58,072,698 N2204H probably damaging Het
Tmem86a C A 7: 47,052,865 P13T probably damaging Het
Tmtc2 A T 10: 105,303,650 S672T probably benign Het
Tox2 G A 2: 163,314,416 S211N possibly damaging Het
Trpc6 A T 9: 8,677,962 E762D probably benign Het
Tshb C T 3: 102,778,145 probably null Het
Ttc3 T A 16: 94,388,272 L163* probably null Het
Twsg1 G T 17: 65,929,551 D161E probably benign Het
Uchl4 A C 9: 64,235,798 D187A probably damaging Het
Vmn2r104 A T 17: 20,048,181 W9R probably benign Het
Zfp14 G A 7: 30,038,595 Q322* probably null Het
Znhit3 G A 11: 84,911,490 P145S probably damaging Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101848206 splice site probably null
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4893:Krt1 UTSW 15 101850120 missense probably damaging 1.00
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5254:Krt1 UTSW 15 101846368 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5869:Krt1 UTSW 15 101850131 missense probably damaging 1.00
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
R8416:Krt1 UTSW 15 101850378 small deletion probably benign
R8418:Krt1 UTSW 15 101850378 small deletion probably benign
R8842:Krt1 UTSW 15 101850378 small deletion probably benign
R8914:Krt1 UTSW 15 101850378 small deletion probably benign
R8964:Krt1 UTSW 15 101850378 small deletion probably benign
R8979:Krt1 UTSW 15 101846905 missense probably benign 0.12
R8988:Krt1 UTSW 15 101850378 small deletion probably benign
RF003:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCCAGAGGACTTAACGC -3'
(R):5'- GATGTCTGGAGAGTGCACTC -3'

Sequencing Primer
(F):5'- GAGGACTTAACGCCACCG -3'
(R):5'- AGAGTGCACTCCCAACGTGAG -3'
Posted On2015-09-25