Incidental Mutation 'R4625:Btnl1'
ID 346526
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission 041890-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4625 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34598725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably null
Transcript: ENSMUST00000080254
AA Change: I114V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: I114V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Meta Mutation Damage Score 0.7638 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A C 5: 144,981,693 (GRCm39) E176A possibly damaging Het
Abcc2 A G 19: 43,792,178 (GRCm39) I320V probably benign Het
Abtb1 C T 6: 88,813,269 (GRCm39) A466T probably benign Het
Ak6 C A 13: 100,792,181 (GRCm39) T208K probably benign Het
Albfm1 G T 5: 90,719,611 (GRCm39) V236L probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Anapc15 T A 7: 101,550,239 (GRCm39) probably benign Het
Anxa2r1 G T 13: 120,496,765 (GRCm39) R35S possibly damaging Het
Aopep T C 13: 63,215,906 (GRCm39) S393P probably benign Het
Aspn A G 13: 49,710,901 (GRCm39) D182G probably benign Het
Astn1 A T 1: 158,407,864 (GRCm39) D607V probably damaging Het
Ccdc159 A G 9: 21,840,762 (GRCm39) S110G probably benign Het
Cdh18 A C 15: 22,714,128 (GRCm39) probably benign Het
Cdh22 A G 2: 164,954,526 (GRCm39) I665T probably damaging Het
Cenpk T A 13: 104,385,901 (GRCm39) H265Q possibly damaging Het
Chd6 A G 2: 160,811,412 (GRCm39) L1397P probably damaging Het
Chia1 A C 3: 106,036,256 (GRCm39) N279H probably benign Het
Cyp8b1 T C 9: 121,744,651 (GRCm39) E227G probably damaging Het
Dmxl2 A T 9: 54,311,404 (GRCm39) N1772K possibly damaging Het
Dnah2 A G 11: 69,354,487 (GRCm39) S2244P probably damaging Het
Fshr T C 17: 89,293,148 (GRCm39) Y510C probably damaging Het
Gm5087 T C 14: 13,158,798 (GRCm38) noncoding transcript Het
Gm7135 A C 1: 97,387,351 (GRCm39) noncoding transcript Het
Hnrnpll A T 17: 80,358,291 (GRCm39) Y153* probably null Het
Htt T A 5: 34,987,129 (GRCm39) V1116E probably damaging Het
Ikzf5 A T 7: 130,995,482 (GRCm39) probably null Het
Kcnb1 A G 2: 167,030,153 (GRCm39) S131P probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kctd21 A G 7: 96,996,782 (GRCm39) D85G probably damaging Het
Kera A G 10: 97,445,493 (GRCm39) N284S probably benign Het
Kif1a A T 1: 92,970,381 (GRCm39) D952E probably benign Het
Klf4 A G 4: 55,530,370 (GRCm39) V247A probably benign Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Lamc1 A G 1: 153,118,442 (GRCm39) S910P probably benign Het
Lin9 T A 1: 180,516,845 (GRCm39) N512K probably damaging Het
Mroh2a A T 1: 88,182,687 (GRCm39) N1205I possibly damaging Het
Mrps30 A G 13: 118,523,250 (GRCm39) V174A probably benign Het
Myo1g T C 11: 6,462,240 (GRCm39) E574G probably damaging Het
Nphp3 G A 9: 103,913,358 (GRCm39) G997R possibly damaging Het
Obscn A G 11: 58,958,084 (GRCm39) C3748R probably damaging Het
Or1j17 A G 2: 36,578,083 (GRCm39) D23G probably benign Het
Or5p69 T C 7: 107,966,895 (GRCm39) L66P probably damaging Het
Or8g28 A T 9: 39,169,614 (GRCm39) M118K probably damaging Het
Or9s18 T A 13: 65,300,674 (GRCm39) V212D possibly damaging Het
Orc5 G T 5: 22,753,003 (GRCm39) F10L probably benign Het
Ptch1 T C 13: 63,670,978 (GRCm39) T851A probably benign Het
Ranbp6 A T 19: 29,788,263 (GRCm39) Y696* probably null Het
Rbp3 A G 14: 33,678,056 (GRCm39) Q668R probably benign Het
Rfwd3 T C 8: 112,002,990 (GRCm39) T611A probably benign Het
Rhcg T A 7: 79,251,352 (GRCm39) D219V probably damaging Het
Rmi1 A G 13: 58,556,950 (GRCm39) R400G probably benign Het
Slc25a26 G T 6: 94,484,633 (GRCm39) V58F probably damaging Het
Smarca5 T A 8: 81,437,192 (GRCm39) K721N probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Speer2 A T 16: 69,655,642 (GRCm39) Y61* probably null Het
Spef2 T C 15: 9,647,524 (GRCm39) Y961C probably damaging Het
Sptb C A 12: 76,634,100 (GRCm39) probably null Het
Svep1 T G 4: 58,072,698 (GRCm39) N2204H probably damaging Het
Tex56 G A 13: 35,116,448 (GRCm39) G66S probably damaging Het
Tmem86a C A 7: 46,702,613 (GRCm39) P13T probably damaging Het
Tmt1a A T 15: 100,210,939 (GRCm39) Q170L probably damaging Het
Tmtc2 A T 10: 105,139,511 (GRCm39) S672T probably benign Het
Tox2 G A 2: 163,156,336 (GRCm39) S211N possibly damaging Het
Trpc6 A T 9: 8,677,963 (GRCm39) E762D probably benign Het
Tshb C T 3: 102,685,461 (GRCm39) probably null Het
Ttc3 T A 16: 94,189,131 (GRCm39) L163* probably null Het
Twsg1 G T 17: 66,236,546 (GRCm39) D161E probably benign Het
Uchl4 A C 9: 64,143,080 (GRCm39) D187A probably damaging Het
Vmn2r104 A T 17: 20,268,443 (GRCm39) W9R probably benign Het
Yju2 T A 17: 56,271,598 (GRCm39) L173Q probably damaging Het
Zfp14 G A 7: 29,738,020 (GRCm39) Q322* probably null Het
Znhit3 G A 11: 84,802,316 (GRCm39) P145S probably damaging Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34,598,578 (GRCm39) missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCCCATCACTGTCCTG -3'
(R):5'- AGGTTCAGAAATGTAAAGTCTGTG -3'

Sequencing Primer
(F):5'- CCAGCTGTCTCCTGAACAGAGTG -3'
(R):5'- AAGTCTGTGATGTTAAACTCTGATGG -3'
Posted On 2015-09-25