Incidental Mutation 'R3086:Rnps1'
ID346534
Institutional Source Beutler Lab
Gene Symbol Rnps1
Ensembl Gene ENSMUSG00000034681
Gene Nameribonucleic acid binding protein S1
Synonyms
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3086 (G1)
Quality Score35
Status Validated
Chromosome17
Chromosomal Location24414675-24425895 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 24412419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000088512] [ENSMUST00000115371] [ENSMUST00000117337] [ENSMUST00000163717]
Predicted Effect probably benign
Transcript: ENSMUST00000039013
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079594
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084725
Predicted Effect probably benign
Transcript: ENSMUST00000088512
SMART Domains Protein: ENSMUSP00000085867
Gene: ENSMUSG00000034681

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115371
SMART Domains Protein: ENSMUSP00000111028
Gene: ENSMUSG00000034681

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 32 134 N/A INTRINSIC
RRM 139 213 5.12e-21 SMART
low complexity region 220 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117337
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163717
SMART Domains Protein: ENSMUSP00000126345
Gene: ENSMUSG00000034681

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181760
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kif20b T C 19: 34,929,715 F128S probably damaging Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Rnps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Rnps1 APN 17 24422299 missense probably damaging 1.00
IGL01433:Rnps1 APN 17 24424545 critical splice donor site probably null
IGL01984:Rnps1 APN 17 24424397 splice site probably benign
IGL03410:Rnps1 APN 17 24421861 splice site probably benign
unbalanced UTSW 17 24422168 missense probably damaging 1.00
R0594:Rnps1 UTSW 17 24424437 missense probably damaging 0.99
R1397:Rnps1 UTSW 17 24412057 unclassified probably benign
R1938:Rnps1 UTSW 17 24420390 missense unknown
R2321:Rnps1 UTSW 17 24422168 missense probably damaging 1.00
R3085:Rnps1 UTSW 17 24412419 unclassified probably benign
R4296:Rnps1 UTSW 17 24425115 unclassified probably benign
R5159:Rnps1 UTSW 17 24418512 missense unknown
R5193:Rnps1 UTSW 17 24418543 missense probably benign 0.23
R5753:Rnps1 UTSW 17 24418164 intron probably benign
R7378:Rnps1 UTSW 17 24418530 missense unknown
R7403:Rnps1 UTSW 17 24425087 missense unknown
R7690:Rnps1 UTSW 17 24418194 missense unknown
R8104:Rnps1 UTSW 17 24424510 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTACACTTGATTTATAAAGCCCAG -3'
(R):5'- ACCGAAGAAGCTGGGCTAAC -3'

Sequencing Primer
(F):5'- ATAAAGCCCAGGATATTTAGCAAC -3'
(R):5'- GGGCTAACAGCTTCTCCC -3'
Posted On2015-09-29