Incidental Mutation 'R0255:Hydin'
ID34679
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 038486-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R0255 (G1)
Quality Score207
Status Validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110565018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3381 (T3381A)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: T3381A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: T3381A

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,045 F119S probably damaging Het
1810011H11Rik A G 14: 32,808,363 K83E possibly damaging Het
Abca13 C A 11: 9,581,545 Q4591K probably damaging Het
Anapc1 A T 2: 128,634,711 M1329K probably damaging Het
Aoah A T 13: 20,979,540 K338* probably null Het
Ascc3 A T 10: 50,645,058 T416S probably benign Het
Baz2a A G 10: 128,114,639 T484A possibly damaging Het
Btnl6 T C 17: 34,508,503 N351S probably benign Het
Cacna1s T G 1: 136,118,806 I1772S possibly damaging Het
Ccdc8 A G 7: 16,995,657 D357G unknown Het
Ccna1 T C 3: 55,050,628 E152G probably damaging Het
Cct4 A G 11: 22,999,073 D273G probably damaging Het
Cd9 A G 6: 125,463,740 V96A probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh7 T C 1: 109,994,306 S43P probably benign Het
Cep95 G A 11: 106,811,271 V365M probably benign Het
Ces1c T C 8: 93,127,524 T128A probably benign Het
Chil5 A G 3: 106,019,267 V82A probably damaging Het
Clmn T C 12: 104,781,764 D508G probably benign Het
Cog8 A T 8: 107,049,145 probably benign Het
Cst3 A T 2: 148,875,169 V70E probably damaging Het
Ctcf A G 8: 105,664,039 T93A possibly damaging Het
Ctsk C A 3: 95,508,877 N315K probably benign Het
Cyp2j12 G T 4: 96,141,025 D6E probably benign Het
Dhx34 A G 7: 16,205,992 V655A probably benign Het
Dock10 T C 1: 80,605,876 Y203C probably damaging Het
Dok7 A T 5: 35,064,334 D26V probably damaging Het
Epha8 G A 4: 136,940,286 H295Y probably damaging Het
Esf1 A G 2: 140,148,923 probably benign Het
Fam83c A G 2: 155,829,752 S588P probably benign Het
Fat3 G A 9: 15,969,706 probably benign Het
Fhdc1 T C 3: 84,453,510 probably benign Het
Frmd4b A G 6: 97,308,086 V338A probably damaging Het
Fsd1l A G 4: 53,694,727 T394A probably damaging Het
Gbf1 A G 19: 46,254,110 probably benign Het
Glg1 G T 8: 111,159,858 Q1101K possibly damaging Het
Glt8d2 T A 10: 82,651,527 probably null Het
Gm19345 T C 7: 19,854,930 probably benign Het
Gpr179 A T 11: 97,336,066 D1754E probably benign Het
Igkv12-41 G A 6: 69,858,838 T16I possibly damaging Het
Insl5 A G 4: 103,018,116 *146Q probably null Het
Iqce A T 5: 140,666,202 I655N possibly damaging Het
Irf2bp1 G A 7: 19,005,002 R189H possibly damaging Het
Itsn1 C T 16: 91,806,090 probably benign Het
Kansl3 A T 1: 36,344,969 I724N probably benign Het
Kcna4 T C 2: 107,296,562 I547T probably damaging Het
Klk1b4 A T 7: 44,210,734 I91F probably benign Het
Lmbr1 A G 5: 29,252,755 S282P probably damaging Het
Lrrc17 G A 5: 21,560,969 A150T probably benign Het
Lrrc2 A G 9: 110,980,898 E334G possibly damaging Het
Lrrc7 G A 3: 158,160,838 Q1077* probably null Het
Mapk8 A T 14: 33,387,307 probably benign Het
Mast1 T A 8: 84,912,021 T1560S probably benign Het
Mdh1b C A 1: 63,719,618 A272S probably damaging Het
Myo15b T C 11: 115,886,283 Y912H probably damaging Het
Nf1 T G 11: 79,408,699 probably null Het
Nme7 T A 1: 164,345,375 D218E probably damaging Het
Nsun7 T A 5: 66,289,408 probably benign Het
Nxpe2 A G 9: 48,340,570 probably null Het
Olfr135 T G 17: 38,208,395 I50R probably benign Het
Olfr394 A G 11: 73,887,829 V181A probably benign Het
Olfr473 T A 7: 107,934,168 V216D probably damaging Het
Olfr698 G A 7: 106,752,989 T133I probably benign Het
P2ry1 T C 3: 61,003,530 V30A probably benign Het
Pgm1 T A 5: 64,112,043 I491N possibly damaging Het
Pkd1l3 A T 8: 109,638,754 D1169V probably damaging Het
Poldip2 T A 11: 78,512,363 S18T probably benign Het
Ppp1r32 C T 19: 10,475,054 R364Q probably damaging Het
Pqlc1 C T 18: 80,263,518 A101V probably benign Het
Prg4 C T 1: 150,455,807 probably benign Het
Prkab2 T A 3: 97,667,412 Y241* probably null Het
Prmt7 A G 8: 106,227,207 probably benign Het
Proser3 T A 7: 30,546,417 R80W probably damaging Het
Prr12 A G 7: 45,049,991 probably benign Het
Psmd1 A T 1: 86,078,582 L223F probably damaging Het
Rab13 A G 3: 90,223,781 probably benign Het
Rgl1 C T 1: 152,552,596 C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 noncoding transcript Het
Rusc2 T C 4: 43,423,954 V1036A probably damaging Het
Sae1 T A 7: 16,370,322 K121* probably null Het
Sap130 C T 18: 31,680,506 P539S probably damaging Het
Scube2 A G 7: 109,824,872 L475P probably damaging Het
Sec16a T C 2: 26,431,186 D1298G probably damaging Het
Serpinb9b T C 13: 33,038,020 F206L probably benign Het
Sh3bp1 T A 15: 78,904,334 Y202* probably null Het
Shprh T A 10: 11,186,391 C1177S possibly damaging Het
Slc27a6 T C 18: 58,609,865 Y542H possibly damaging Het
Slc41a1 T C 1: 131,843,912 probably benign Het
Slc46a1 T C 11: 78,470,799 F424L probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc6a20a A G 9: 123,664,621 V65A probably damaging Het
Slc9c1 T A 16: 45,554,300 S343T probably benign Het
Spcs3 C A 8: 54,528,380 R60I probably benign Het
Ssfa2 T A 2: 79,660,466 L976Q probably damaging Het
Tbc1d16 C A 11: 119,147,575 R764L possibly damaging Het
Tcaf2 A T 6: 42,642,904 V63E possibly damaging Het
Tmc1 G T 19: 20,789,587 A750E possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tmx3 T C 18: 90,540,006 I394T probably damaging Het
Trank1 G A 9: 111,366,024 E1039K possibly damaging Het
Trpc4ap A G 2: 155,657,946 probably benign Het
Tsen54 T C 11: 115,815,408 C123R probably damaging Het
Ubtd1 A G 19: 42,031,934 D39G possibly damaging Het
Vmn1r181 A T 7: 23,984,334 M75L probably benign Het
Zc3h7a T C 16: 11,140,737 T847A probably damaging Het
Zc3hav1 A G 6: 38,336,550 C187R probably damaging Het
Zfp692 G A 11: 58,310,403 probably benign Het
Zmiz1 G A 14: 25,654,495 probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
Franz_joseph UTSW 8 110601318 missense probably damaging 1.00
maria UTSW 8 110509127 splice site probably benign
teresa UTSW 8 110609671 missense possibly damaging 0.79
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6980:Hydin UTSW 8 110413284 missense possibly damaging 0.91
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
R7061:Hydin UTSW 8 110603288 missense possibly damaging 0.90
R7085:Hydin UTSW 8 110603330 missense probably benign 0.03
R7086:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R7110:Hydin UTSW 8 110354951 critical splice acceptor site probably null
R7158:Hydin UTSW 8 110609671 missense possibly damaging 0.79
R7163:Hydin UTSW 8 110603336 missense probably benign 0.25
R7209:Hydin UTSW 8 110489792 nonsense probably null
R7244:Hydin UTSW 8 110549675 missense probably damaging 0.98
R7347:Hydin UTSW 8 110600362 missense probably benign 0.06
R7349:Hydin UTSW 8 110398171 splice site probably null
R7359:Hydin UTSW 8 110506101 missense probably damaging 0.98
R7365:Hydin UTSW 8 110557662 missense probably damaging 0.99
R7365:Hydin UTSW 8 110601273 missense probably damaging 1.00
R7436:Hydin UTSW 8 110583914 missense probably damaging 0.96
R7528:Hydin UTSW 8 110380572 nonsense probably null
R7544:Hydin UTSW 8 110589525 missense probably benign 0.35
R7625:Hydin UTSW 8 110541844 missense probably benign 0.01
R7713:Hydin UTSW 8 110593812 missense possibly damaging 0.69
R7763:Hydin UTSW 8 110505843 missense possibly damaging 0.92
R7771:Hydin UTSW 8 110565085 missense probably damaging 0.97
R7794:Hydin UTSW 8 110509083 missense probably damaging 1.00
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGACTTCTGTATGCTTGGCAAGTACTG -3'
(R):5'- AGAACCTCCTACCTTGTTGGAGATGG -3'

Sequencing Primer
(F):5'- tctctctctctctttcttcccc -3'
(R):5'- TGGAGATGGGCTTGATGACAATG -3'
Posted On2013-05-09