Incidental Mutation 'R0255:Abca13'

• ID: 34690
• Institutional Source: Beutler Lab
• Gene Symbol: Abca13
• Ensembl Gene: ENSMUSG00000004668
• Gene Name: ATP-binding cassette, sub-family A (ABC1), member 13
• Synonyms: A930002G16Rik
• MMRRC Submission: 038486-MU
• Accession Numbers:

  NCBI RefSeq: NM_178259.3; MGI:2388707

• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R0255 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 11
• Chromosomal Location: 9191942-9684259 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to A at 9581545 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Glutamine to Lysine at position 4591 (Q4591K)
• Ref Sequence: ENSEMBL: ENSMUSP00000040465
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000042740]
• AlphaFold: no structure available at present
• Predicted Effect: probably damaging; Transcript: ENSMUST00000042740; AA Change: Q4591K; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000040465; Gene: ENSMUSG00000004668; AA Change: Q4591K

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	358	379	N/A	INTRINSIC
low complexity region	441	451	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
low complexity region	1382	1393	N/A	INTRINSIC
low complexity region	1721	1737	N/A	INTRINSIC
low complexity region	1859	1872	N/A	INTRINSIC
Pfam:ABC2_membrane_3	3288	3740	4.7e-21	PFAM
low complexity region	3796	3809	N/A	INTRINSIC
AAA	3835	4019	8.08e-12	SMART
transmembrane domain	4206	4228	N/A	INTRINSIC
Pfam:ABC2_membrane_3	4317	4646	1.6e-33	PFAM
AAA	4721	4909	8.86e-9	SMART

• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
• Validation Efficiency: 93% (102/110)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
• Allele List at MGI:

  All alleles(3) : Targeted(3)

• Posted On: 2013-05-09

Predicted Primers

PCR Primer
(F):5'- GCTGTCTGAGAGTGTCTCTGAGTAACC -3'
(R):5'- TCTTGAAAACTCCAGGTGGACTTTTCC -3'

Sequencing Primer
(F):5'- GTGTCTCTGAGTAACCAGGATAG -3'
(R):5'- TCTCAGAAGGTCTCCATGTAAC -3'

Protein Function and Prediction

Abca13 encodes ABCA13, a member of the ATP-binding cassette (ABC) transporter superfamily.  The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. ABCA13 has two transmembrane domains, each with six membrane-spanning segments, and two nucleotide-binding domains located in the cytoplasm. Due to ubiquitous expression of Abca13 in blood-derived cells, a role associated with hematopoiesis has been suggested for ABCA13. However, the exact function and substrates for ABCA13 remain to be deterimined.

ABCA13 is expressed at high levels in the trachea, testis, and bone marrow. In the mouse, PCR analysis detected Abca13 is expressed in the kidney and skeletal muscle.

ABCA13 was identified as a susceptibility factor for schizophrenia, bipolar disorder, and major depression. In humans, ABCA13 maps to chromosome 7p12.3, a region linked to Schwachman-Diamond syndrome, a genetic disorder affecting the pancreas, and a locus involved in T-cell tumor invasion and cancer metastasis. High levels of ABCA13 are found in leukemia, prostate tumor, and CNS tumor cell lines.