Incidental Mutation 'R0255:Nf1'
ID 34696
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Nf-1, neurofibromin
MMRRC Submission 038486-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306
Essential gene? Essential (E-score: 1.000) question?
Stock # R0255 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 79339693-79581612 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 79408699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131800
Predicted Effect probably null
Transcript: ENSMUST00000219057
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,045 F119S probably damaging Het
1810011H11Rik A G 14: 32,808,363 K83E possibly damaging Het
Abca13 C A 11: 9,581,545 Q4591K probably damaging Het
Anapc1 A T 2: 128,634,711 M1329K probably damaging Het
Aoah A T 13: 20,979,540 K338* probably null Het
Ascc3 A T 10: 50,645,058 T416S probably benign Het
Baz2a A G 10: 128,114,639 T484A possibly damaging Het
Btnl6 T C 17: 34,508,503 N351S probably benign Het
Cacna1s T G 1: 136,118,806 I1772S possibly damaging Het
Ccdc8 A G 7: 16,995,657 D357G unknown Het
Ccna1 T C 3: 55,050,628 E152G probably damaging Het
Cct4 A G 11: 22,999,073 D273G probably damaging Het
Cd9 A G 6: 125,463,740 V96A probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh7 T C 1: 109,994,306 S43P probably benign Het
Cep95 G A 11: 106,811,271 V365M probably benign Het
Ces1c T C 8: 93,127,524 T128A probably benign Het
Chil5 A G 3: 106,019,267 V82A probably damaging Het
Clmn T C 12: 104,781,764 D508G probably benign Het
Cog8 A T 8: 107,049,145 probably benign Het
Cst3 A T 2: 148,875,169 V70E probably damaging Het
Ctcf A G 8: 105,664,039 T93A possibly damaging Het
Ctsk C A 3: 95,508,877 N315K probably benign Het
Cyp2j12 G T 4: 96,141,025 D6E probably benign Het
Dhx34 A G 7: 16,205,992 V655A probably benign Het
Dock10 T C 1: 80,605,876 Y203C probably damaging Het
Dok7 A T 5: 35,064,334 D26V probably damaging Het
Epha8 G A 4: 136,940,286 H295Y probably damaging Het
Esf1 A G 2: 140,148,923 probably benign Het
Fam83c A G 2: 155,829,752 S588P probably benign Het
Fat3 G A 9: 15,969,706 probably benign Het
Fhdc1 T C 3: 84,453,510 probably benign Het
Frmd4b A G 6: 97,308,086 V338A probably damaging Het
Fsd1l A G 4: 53,694,727 T394A probably damaging Het
Gbf1 A G 19: 46,254,110 probably benign Het
Glg1 G T 8: 111,159,858 Q1101K possibly damaging Het
Glt8d2 T A 10: 82,651,527 probably null Het
Gm19345 T C 7: 19,854,930 probably benign Het
Gpr179 A T 11: 97,336,066 D1754E probably benign Het
Hydin A G 8: 110,565,018 T3381A probably benign Het
Igkv12-41 G A 6: 69,858,838 T16I possibly damaging Het
Insl5 A G 4: 103,018,116 *146Q probably null Het
Iqce A T 5: 140,666,202 I655N possibly damaging Het
Irf2bp1 G A 7: 19,005,002 R189H possibly damaging Het
Itsn1 C T 16: 91,806,090 probably benign Het
Kansl3 A T 1: 36,344,969 I724N probably benign Het
Kcna4 T C 2: 107,296,562 I547T probably damaging Het
Klk1b4 A T 7: 44,210,734 I91F probably benign Het
Lmbr1 A G 5: 29,252,755 S282P probably damaging Het
Lrrc17 G A 5: 21,560,969 A150T probably benign Het
Lrrc2 A G 9: 110,980,898 E334G possibly damaging Het
Lrrc7 G A 3: 158,160,838 Q1077* probably null Het
Mapk8 A T 14: 33,387,307 probably benign Het
Mast1 T A 8: 84,912,021 T1560S probably benign Het
Mdh1b C A 1: 63,719,618 A272S probably damaging Het
Myo15b T C 11: 115,886,283 Y912H probably damaging Het
Nme7 T A 1: 164,345,375 D218E probably damaging Het
Nsun7 T A 5: 66,289,408 probably benign Het
Nxpe2 A G 9: 48,340,570 probably null Het
Olfr135 T G 17: 38,208,395 I50R probably benign Het
Olfr394 A G 11: 73,887,829 V181A probably benign Het
Olfr473 T A 7: 107,934,168 V216D probably damaging Het
Olfr698 G A 7: 106,752,989 T133I probably benign Het
P2ry1 T C 3: 61,003,530 V30A probably benign Het
Pgm1 T A 5: 64,112,043 I491N possibly damaging Het
Pkd1l3 A T 8: 109,638,754 D1169V probably damaging Het
Poldip2 T A 11: 78,512,363 S18T probably benign Het
Ppp1r32 C T 19: 10,475,054 R364Q probably damaging Het
Pqlc1 C T 18: 80,263,518 A101V probably benign Het
Prg4 C T 1: 150,455,807 probably benign Het
Prkab2 T A 3: 97,667,412 Y241* probably null Het
Prmt7 A G 8: 106,227,207 probably benign Het
Proser3 T A 7: 30,546,417 R80W probably damaging Het
Prr12 A G 7: 45,049,991 probably benign Het
Psmd1 A T 1: 86,078,582 L223F probably damaging Het
Rab13 A G 3: 90,223,781 probably benign Het
Rgl1 C T 1: 152,552,596 C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 noncoding transcript Het
Rusc2 T C 4: 43,423,954 V1036A probably damaging Het
Sae1 T A 7: 16,370,322 K121* probably null Het
Sap130 C T 18: 31,680,506 P539S probably damaging Het
Scube2 A G 7: 109,824,872 L475P probably damaging Het
Sec16a T C 2: 26,431,186 D1298G probably damaging Het
Serpinb9b T C 13: 33,038,020 F206L probably benign Het
Sh3bp1 T A 15: 78,904,334 Y202* probably null Het
Shprh T A 10: 11,186,391 C1177S possibly damaging Het
Slc27a6 T C 18: 58,609,865 Y542H possibly damaging Het
Slc41a1 T C 1: 131,843,912 probably benign Het
Slc46a1 T C 11: 78,470,799 F424L probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc6a20a A G 9: 123,664,621 V65A probably damaging Het
Slc9c1 T A 16: 45,554,300 S343T probably benign Het
Spcs3 C A 8: 54,528,380 R60I probably benign Het
Ssfa2 T A 2: 79,660,466 L976Q probably damaging Het
Tbc1d16 C A 11: 119,147,575 R764L possibly damaging Het
Tcaf2 A T 6: 42,642,904 V63E possibly damaging Het
Tmc1 G T 19: 20,789,587 A750E possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tmx3 T C 18: 90,540,006 I394T probably damaging Het
Trank1 G A 9: 111,366,024 E1039K possibly damaging Het
Trpc4ap A G 2: 155,657,946 probably benign Het
Tsen54 T C 11: 115,815,408 C123R probably damaging Het
Ubtd1 A G 19: 42,031,934 D39G possibly damaging Het
Vmn1r181 A T 7: 23,984,334 M75L probably benign Het
Zc3h7a T C 16: 11,140,737 T847A probably damaging Het
Zc3hav1 A G 6: 38,336,550 C187R probably damaging Het
Zfp692 G A 11: 58,310,403 probably benign Het
Zmiz1 G A 14: 25,654,495 probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Eyecandy UTSW 11 79545465 missense probably damaging 1.00
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
hancock UTSW 11 79536850 missense probably benign
independence UTSW 11 79454310 intron probably benign
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
responsibility UTSW 11 79565975 missense probably damaging 0.99
weepy UTSW 11 79546986 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 splice site probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 splice site probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79578331 missense probably damaging 0.96
R8244:Nf1 UTSW 11 79440924 missense probably benign
R8397:Nf1 UTSW 11 79547692 missense probably damaging 1.00
R8436:Nf1 UTSW 11 79458883 missense probably damaging 0.99
R8492:Nf1 UTSW 11 79408422 missense probably benign 0.06
R8719:Nf1 UTSW 11 79390293 missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79454310 intron probably benign
R8795:Nf1 UTSW 11 79425616 missense probably damaging 1.00
R8797:Nf1 UTSW 11 79475885 critical splice donor site probably benign
R8809:Nf1 UTSW 11 79547138 missense probably damaging 0.99
R8812:Nf1 UTSW 11 79546354 missense probably damaging 0.96
R8815:Nf1 UTSW 11 79441665 missense probably damaging 1.00
R8828:Nf1 UTSW 11 79395853 critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79445793 missense probably damaging 1.00
R9051:Nf1 UTSW 11 79473342 missense probably damaging 1.00
R9103:Nf1 UTSW 11 79559506 missense probably damaging 0.99
R9142:Nf1 UTSW 11 79471489 missense probably damaging 1.00
R9142:Nf1 UTSW 11 79475862 missense probably damaging 1.00
R9170:Nf1 UTSW 11 79545465 missense probably damaging 1.00
R9201:Nf1 UTSW 11 79570330 missense probably benign 0.08
R9267:Nf1 UTSW 11 79440890 missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79556803 missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79547192 missense probably damaging 0.99
R9471:Nf1 UTSW 11 79545369 missense probably damaging 0.99
R9630:Nf1 UTSW 11 79411644 missense probably damaging 1.00
R9664:Nf1 UTSW 11 79443907 missense probably damaging 1.00
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79564925 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAGAAGGTTGCACAGTTGG -3'
(R):5'- CCACTTGCTCAGAAGGGAAAGGAC -3'

Sequencing Primer
(F):5'- AGGTAAGCTTCAACCTCTTGG -3'
(R):5'- CTGTAATTCCTGTTAGAGCTGAAC -3'
Posted On 2013-05-09