Incidental Mutation 'R0255:Tbc1d16'
ID 34701
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene Name TBC1 domain family, member 16
Synonyms
MMRRC Submission 038486-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0255 (G1)
Quality Score 131
Status Validated
Chromosome 11
Chromosomal Location 119033871-119119325 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119038401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 764 (R764L)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
AlphaFold A2ABG4
Predicted Effect possibly damaging
Transcript: ENSMUST00000036113
AA Change: R765L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: R765L

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect possibly damaging
Transcript: ENSMUST00000207655
AA Change: R764L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,061,907 (GRCm39) F119S probably damaging Het
Abca13 C A 11: 9,531,545 (GRCm39) Q4591K probably damaging Het
Anapc1 A T 2: 128,476,631 (GRCm39) M1329K probably damaging Het
Aoah A T 13: 21,163,710 (GRCm39) K338* probably null Het
Ascc3 A T 10: 50,521,154 (GRCm39) T416S probably benign Het
Baz2a A G 10: 127,950,508 (GRCm39) T484A possibly damaging Het
Btnl6 T C 17: 34,727,477 (GRCm39) N351S probably benign Het
Cacna1s T G 1: 136,046,544 (GRCm39) I1772S possibly damaging Het
Ccdc8 A G 7: 16,729,582 (GRCm39) D357G unknown Het
Ccna1 T C 3: 54,958,049 (GRCm39) E152G probably damaging Het
Cct4 A G 11: 22,949,073 (GRCm39) D273G probably damaging Het
Cd9 A G 6: 125,440,703 (GRCm39) V96A probably damaging Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cdh20 T C 1: 109,922,036 (GRCm39) S43P probably benign Het
Cep95 G A 11: 106,702,097 (GRCm39) V365M probably benign Het
Ces1c T C 8: 93,854,152 (GRCm39) T128A probably benign Het
Chil5 A G 3: 105,926,583 (GRCm39) V82A probably damaging Het
Clmn T C 12: 104,748,023 (GRCm39) D508G probably benign Het
Cog8 A T 8: 107,775,777 (GRCm39) probably benign Het
Cst3 A T 2: 148,717,089 (GRCm39) V70E probably damaging Het
Ctcf A G 8: 106,390,671 (GRCm39) T93A possibly damaging Het
Ctsk C A 3: 95,416,188 (GRCm39) N315K probably benign Het
Cyp2j12 G T 4: 96,029,262 (GRCm39) D6E probably benign Het
Dhx34 A G 7: 15,939,917 (GRCm39) V655A probably benign Het
Dock10 T C 1: 80,583,593 (GRCm39) Y203C probably damaging Het
Dok7 A T 5: 35,221,678 (GRCm39) D26V probably damaging Het
Epha8 G A 4: 136,667,597 (GRCm39) H295Y probably damaging Het
Esf1 A G 2: 139,990,843 (GRCm39) probably benign Het
Fam83c A G 2: 155,671,672 (GRCm39) S588P probably benign Het
Fat3 G A 9: 15,881,002 (GRCm39) probably benign Het
Fhdc1 T C 3: 84,360,817 (GRCm39) probably benign Het
Frmd4b A G 6: 97,285,047 (GRCm39) V338A probably damaging Het
Fsd1l A G 4: 53,694,727 (GRCm39) T394A probably damaging Het
Gbf1 A G 19: 46,242,549 (GRCm39) probably benign Het
Glg1 G T 8: 111,886,490 (GRCm39) Q1101K possibly damaging Het
Glt8d2 T A 10: 82,487,361 (GRCm39) probably null Het
Gm19345 T C 7: 19,588,855 (GRCm39) probably benign Het
Gpr179 A T 11: 97,226,892 (GRCm39) D1754E probably benign Het
Hydin A G 8: 111,291,650 (GRCm39) T3381A probably benign Het
Igkv12-41 G A 6: 69,835,822 (GRCm39) T16I possibly damaging Het
Insl5 A G 4: 102,875,313 (GRCm39) *146Q probably null Het
Iqce A T 5: 140,651,957 (GRCm39) I655N possibly damaging Het
Irf2bp1 G A 7: 18,738,927 (GRCm39) R189H possibly damaging Het
Itprid2 T A 2: 79,490,810 (GRCm39) L976Q probably damaging Het
Itsn1 C T 16: 91,602,978 (GRCm39) probably benign Het
Kansl3 A T 1: 36,384,050 (GRCm39) I724N probably benign Het
Kcna4 T C 2: 107,126,907 (GRCm39) I547T probably damaging Het
Klk1b4 A T 7: 43,860,158 (GRCm39) I91F probably benign Het
Lmbr1 A G 5: 29,457,753 (GRCm39) S282P probably damaging Het
Lrrc17 G A 5: 21,765,967 (GRCm39) A150T probably benign Het
Lrrc2 A G 9: 110,809,966 (GRCm39) E334G possibly damaging Het
Lrrc7 G A 3: 157,866,475 (GRCm39) Q1077* probably null Het
Mapk8 A T 14: 33,109,264 (GRCm39) probably benign Het
Mast1 T A 8: 85,638,650 (GRCm39) T1560S probably benign Het
Mdh1b C A 1: 63,758,777 (GRCm39) A272S probably damaging Het
Myo15b T C 11: 115,777,109 (GRCm39) Y912H probably damaging Het
Nf1 T G 11: 79,299,525 (GRCm39) probably null Het
Nme7 T A 1: 164,172,944 (GRCm39) D218E probably damaging Het
Nsun7 T A 5: 66,446,751 (GRCm39) probably benign Het
Nxpe2 A G 9: 48,251,870 (GRCm39) probably null Het
Or1e34 A G 11: 73,778,655 (GRCm39) V181A probably benign Het
Or2ag16 G A 7: 106,352,196 (GRCm39) T133I probably benign Het
Or2n1c T G 17: 38,519,286 (GRCm39) I50R probably benign Het
Or5p53 T A 7: 107,533,375 (GRCm39) V216D probably damaging Het
P2ry1 T C 3: 60,910,951 (GRCm39) V30A probably benign Het
Pgm2 T A 5: 64,269,386 (GRCm39) I491N possibly damaging Het
Pkd1l3 A T 8: 110,365,386 (GRCm39) D1169V probably damaging Het
Poldip2 T A 11: 78,403,189 (GRCm39) S18T probably benign Het
Prg4 C T 1: 150,331,558 (GRCm39) probably benign Het
Prkab2 T A 3: 97,574,728 (GRCm39) Y241* probably null Het
Prmt7 A G 8: 106,953,839 (GRCm39) probably benign Het
Proser3 T A 7: 30,245,842 (GRCm39) R80W probably damaging Het
Prr12 A G 7: 44,699,415 (GRCm39) probably benign Het
Psmd1 A T 1: 86,006,304 (GRCm39) L223F probably damaging Het
Rab13 A G 3: 90,131,088 (GRCm39) probably benign Het
Rgl1 C T 1: 152,428,347 (GRCm39) C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 (GRCm38) noncoding transcript Het
Rusc2 T C 4: 43,423,954 (GRCm39) V1036A probably damaging Het
Sae1 T A 7: 16,104,247 (GRCm39) K121* probably null Het
Sap130 C T 18: 31,813,559 (GRCm39) P539S probably damaging Het
Saxo4 C T 19: 10,452,418 (GRCm39) R364Q probably damaging Het
Scube2 A G 7: 109,424,079 (GRCm39) L475P probably damaging Het
Sec16a T C 2: 26,321,198 (GRCm39) D1298G probably damaging Het
Serpinb9b T C 13: 33,222,003 (GRCm39) F206L probably benign Het
Sh3bp1 T A 15: 78,788,534 (GRCm39) Y202* probably null Het
Shprh T A 10: 11,062,135 (GRCm39) C1177S possibly damaging Het
Slc27a6 T C 18: 58,742,937 (GRCm39) Y542H possibly damaging Het
Slc41a1 T C 1: 131,771,650 (GRCm39) probably benign Het
Slc46a1 T C 11: 78,361,625 (GRCm39) F424L probably damaging Het
Slc66a2 C T 18: 80,306,733 (GRCm39) A101V probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc6a20a A G 9: 123,493,686 (GRCm39) V65A probably damaging Het
Slc9c1 T A 16: 45,374,663 (GRCm39) S343T probably benign Het
Spcs3 C A 8: 54,981,415 (GRCm39) R60I probably benign Het
Tcaf2 A T 6: 42,619,838 (GRCm39) V63E possibly damaging Het
Tmc1 G T 19: 20,766,951 (GRCm39) A750E possibly damaging Het
Tmem273 A G 14: 32,530,320 (GRCm39) K83E possibly damaging Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tmx3 T C 18: 90,558,130 (GRCm39) I394T probably damaging Het
Trank1 G A 9: 111,195,092 (GRCm39) E1039K possibly damaging Het
Trpc4ap A G 2: 155,499,866 (GRCm39) probably benign Het
Tsen54 T C 11: 115,706,234 (GRCm39) C123R probably damaging Het
Ubtd1 A G 19: 42,020,373 (GRCm39) D39G possibly damaging Het
Vmn1r181 A T 7: 23,683,759 (GRCm39) M75L probably benign Het
Zc3h7a T C 16: 10,958,601 (GRCm39) T847A probably damaging Het
Zc3hav1 A G 6: 38,313,485 (GRCm39) C187R probably damaging Het
Zfp692 G A 11: 58,201,229 (GRCm39) probably benign Het
Zmiz1 G A 14: 25,654,919 (GRCm39) probably benign Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119,046,901 (GRCm39) missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119,047,533 (GRCm39) missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119,101,372 (GRCm39) missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119,039,840 (GRCm39) nonsense probably null
R0118:Tbc1d16 UTSW 11 119,048,642 (GRCm39) missense probably damaging 1.00
R0330:Tbc1d16 UTSW 11 119,049,555 (GRCm39) critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119,099,864 (GRCm39) missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119,044,830 (GRCm39) missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119,046,927 (GRCm39) missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119,045,904 (GRCm39) splice site probably benign
R2897:Tbc1d16 UTSW 11 119,048,654 (GRCm39) missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119,048,654 (GRCm39) missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119,048,699 (GRCm39) missense possibly damaging 0.86
R5193:Tbc1d16 UTSW 11 119,049,646 (GRCm39) missense probably benign 0.00
R5465:Tbc1d16 UTSW 11 119,046,885 (GRCm39) missense probably benign
R5478:Tbc1d16 UTSW 11 119,045,917 (GRCm39) missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119,049,617 (GRCm39) missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119,049,556 (GRCm39) critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119,101,391 (GRCm39) nonsense probably null
R6233:Tbc1d16 UTSW 11 119,101,391 (GRCm39) nonsense probably null
R6596:Tbc1d16 UTSW 11 119,048,601 (GRCm39) missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119,099,742 (GRCm39) missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119,049,617 (GRCm39) missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119,045,921 (GRCm39) missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119,046,898 (GRCm39) missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119,039,784 (GRCm39) missense probably damaging 0.98
R8532:Tbc1d16 UTSW 11 119,045,993 (GRCm39) missense probably benign 0.11
R8753:Tbc1d16 UTSW 11 119,101,492 (GRCm39) missense probably damaging 1.00
R8839:Tbc1d16 UTSW 11 119,047,474 (GRCm39) missense probably damaging 0.99
R9049:Tbc1d16 UTSW 11 119,100,090 (GRCm39) missense probably damaging 1.00
R9104:Tbc1d16 UTSW 11 119,038,626 (GRCm39) missense probably damaging 1.00
R9378:Tbc1d16 UTSW 11 119,099,666 (GRCm39) missense probably damaging 1.00
R9461:Tbc1d16 UTSW 11 119,044,781 (GRCm39) missense probably damaging 1.00
R9498:Tbc1d16 UTSW 11 119,048,681 (GRCm39) missense probably damaging 0.98
R9544:Tbc1d16 UTSW 11 119,101,335 (GRCm39) missense probably damaging 1.00
R9588:Tbc1d16 UTSW 11 119,101,335 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCACTCAGACAACAATCCTGC -3'
(R):5'- AGCCTCCATGACCTGTGTAAGCTG -3'

Sequencing Primer
(F):5'- TAGCCTTTCAGGAGCTGAAC -3'
(R):5'- TAAGCTGTGTGGGACAGGC -3'
Posted On 2013-05-09