Incidental Mutation 'R0255:Slc9c1'
ID34711
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission 038486-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R0255 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45554300 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 343 (S343T)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: S343T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: S343T

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162151
AA Change: S314T
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 93% (102/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,045 F119S probably damaging Het
1810011H11Rik A G 14: 32,808,363 K83E possibly damaging Het
Abca13 C A 11: 9,581,545 Q4591K probably damaging Het
Anapc1 A T 2: 128,634,711 M1329K probably damaging Het
Aoah A T 13: 20,979,540 K338* probably null Het
Ascc3 A T 10: 50,645,058 T416S probably benign Het
Baz2a A G 10: 128,114,639 T484A possibly damaging Het
Btnl6 T C 17: 34,508,503 N351S probably benign Het
Cacna1s T G 1: 136,118,806 I1772S possibly damaging Het
Ccdc8 A G 7: 16,995,657 D357G unknown Het
Ccna1 T C 3: 55,050,628 E152G probably damaging Het
Cct4 A G 11: 22,999,073 D273G probably damaging Het
Cd9 A G 6: 125,463,740 V96A probably damaging Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh7 T C 1: 109,994,306 S43P probably benign Het
Cep95 G A 11: 106,811,271 V365M probably benign Het
Ces1c T C 8: 93,127,524 T128A probably benign Het
Chil5 A G 3: 106,019,267 V82A probably damaging Het
Clmn T C 12: 104,781,764 D508G probably benign Het
Cog8 A T 8: 107,049,145 probably benign Het
Cst3 A T 2: 148,875,169 V70E probably damaging Het
Ctcf A G 8: 105,664,039 T93A possibly damaging Het
Ctsk C A 3: 95,508,877 N315K probably benign Het
Cyp2j12 G T 4: 96,141,025 D6E probably benign Het
Dhx34 A G 7: 16,205,992 V655A probably benign Het
Dock10 T C 1: 80,605,876 Y203C probably damaging Het
Dok7 A T 5: 35,064,334 D26V probably damaging Het
Epha8 G A 4: 136,940,286 H295Y probably damaging Het
Esf1 A G 2: 140,148,923 probably benign Het
Fam83c A G 2: 155,829,752 S588P probably benign Het
Fat3 G A 9: 15,969,706 probably benign Het
Fhdc1 T C 3: 84,453,510 probably benign Het
Frmd4b A G 6: 97,308,086 V338A probably damaging Het
Fsd1l A G 4: 53,694,727 T394A probably damaging Het
Gbf1 A G 19: 46,254,110 probably benign Het
Glg1 G T 8: 111,159,858 Q1101K possibly damaging Het
Glt8d2 T A 10: 82,651,527 probably null Het
Gm19345 T C 7: 19,854,930 probably benign Het
Gpr179 A T 11: 97,336,066 D1754E probably benign Het
Hydin A G 8: 110,565,018 T3381A probably benign Het
Igkv12-41 G A 6: 69,858,838 T16I possibly damaging Het
Insl5 A G 4: 103,018,116 *146Q probably null Het
Iqce A T 5: 140,666,202 I655N possibly damaging Het
Irf2bp1 G A 7: 19,005,002 R189H possibly damaging Het
Itsn1 C T 16: 91,806,090 probably benign Het
Kansl3 A T 1: 36,344,969 I724N probably benign Het
Kcna4 T C 2: 107,296,562 I547T probably damaging Het
Klk1b4 A T 7: 44,210,734 I91F probably benign Het
Lmbr1 A G 5: 29,252,755 S282P probably damaging Het
Lrrc17 G A 5: 21,560,969 A150T probably benign Het
Lrrc2 A G 9: 110,980,898 E334G possibly damaging Het
Lrrc7 G A 3: 158,160,838 Q1077* probably null Het
Mapk8 A T 14: 33,387,307 probably benign Het
Mast1 T A 8: 84,912,021 T1560S probably benign Het
Mdh1b C A 1: 63,719,618 A272S probably damaging Het
Myo15b T C 11: 115,886,283 Y912H probably damaging Het
Nf1 T G 11: 79,408,699 probably null Het
Nme7 T A 1: 164,345,375 D218E probably damaging Het
Nsun7 T A 5: 66,289,408 probably benign Het
Nxpe2 A G 9: 48,340,570 probably null Het
Olfr135 T G 17: 38,208,395 I50R probably benign Het
Olfr394 A G 11: 73,887,829 V181A probably benign Het
Olfr473 T A 7: 107,934,168 V216D probably damaging Het
Olfr698 G A 7: 106,752,989 T133I probably benign Het
P2ry1 T C 3: 61,003,530 V30A probably benign Het
Pgm1 T A 5: 64,112,043 I491N possibly damaging Het
Pkd1l3 A T 8: 109,638,754 D1169V probably damaging Het
Poldip2 T A 11: 78,512,363 S18T probably benign Het
Ppp1r32 C T 19: 10,475,054 R364Q probably damaging Het
Pqlc1 C T 18: 80,263,518 A101V probably benign Het
Prg4 C T 1: 150,455,807 probably benign Het
Prkab2 T A 3: 97,667,412 Y241* probably null Het
Prmt7 A G 8: 106,227,207 probably benign Het
Proser3 T A 7: 30,546,417 R80W probably damaging Het
Prr12 A G 7: 45,049,991 probably benign Het
Psmd1 A T 1: 86,078,582 L223F probably damaging Het
Rab13 A G 3: 90,223,781 probably benign Het
Rgl1 C T 1: 152,552,596 C294Y probably damaging Het
Rpl21-ps4 C A 14: 11,227,556 noncoding transcript Het
Rusc2 T C 4: 43,423,954 V1036A probably damaging Het
Sae1 T A 7: 16,370,322 K121* probably null Het
Sap130 C T 18: 31,680,506 P539S probably damaging Het
Scube2 A G 7: 109,824,872 L475P probably damaging Het
Sec16a T C 2: 26,431,186 D1298G probably damaging Het
Serpinb9b T C 13: 33,038,020 F206L probably benign Het
Sh3bp1 T A 15: 78,904,334 Y202* probably null Het
Shprh T A 10: 11,186,391 C1177S possibly damaging Het
Slc27a6 T C 18: 58,609,865 Y542H possibly damaging Het
Slc41a1 T C 1: 131,843,912 probably benign Het
Slc46a1 T C 11: 78,470,799 F424L probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc6a20a A G 9: 123,664,621 V65A probably damaging Het
Spcs3 C A 8: 54,528,380 R60I probably benign Het
Ssfa2 T A 2: 79,660,466 L976Q probably damaging Het
Tbc1d16 C A 11: 119,147,575 R764L possibly damaging Het
Tcaf2 A T 6: 42,642,904 V63E possibly damaging Het
Tmc1 G T 19: 20,789,587 A750E possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tmx3 T C 18: 90,540,006 I394T probably damaging Het
Trank1 G A 9: 111,366,024 E1039K possibly damaging Het
Trpc4ap A G 2: 155,657,946 probably benign Het
Tsen54 T C 11: 115,815,408 C123R probably damaging Het
Ubtd1 A G 19: 42,031,934 D39G possibly damaging Het
Vmn1r181 A T 7: 23,984,334 M75L probably benign Het
Zc3h7a T C 16: 11,140,737 T847A probably damaging Het
Zc3hav1 A G 6: 38,336,550 C187R probably damaging Het
Zfp692 G A 11: 58,310,403 probably benign Het
Zmiz1 G A 14: 25,654,495 probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGTTTCTCTGCTACATCATGTTGCAT -3'
(R):5'- ACTCCTGGGCATTACTTTGCTAATGAC -3'

Sequencing Primer
(F):5'- GAGTGTTGATAAATTCCTCCTTCAC -3'
(R):5'- GGCATTACTTTGCTAATGACAACTTG -3'
Posted On2013-05-09