Incidental Mutation 'R0256:Ror1'
ID34737
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0256 (G1)
Quality Score199
Status Validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100409745 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 214 (H214Q)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably benign
Transcript: ENSMUST00000039630
AA Change: H214Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: H214Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Arg1 A G 10: 24,916,458 Y188H probably benign Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Cdh6 T C 15: 13,053,782 probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Fhl5 T C 4: 25,213,624 H104R probably benign Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr813 A T 10: 129,857,037 D173V probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Sval3 A G 6: 41,972,905 D122G probably damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R7914:Ror1 UTSW 4 100441098 missense probably benign 0.01
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCGTGAAAGTGAGATGCTTAGAC -3'
(R):5'- TGGGAATGCCAATCCGTATGCAG -3'

Sequencing Primer
(F):5'- GACATCTGAAATGAATCTCCTTCC -3'
(R):5'- GGAGATCCTCACAGTTTGGTAAC -3'
Posted On2013-05-09