Incidental Mutation 'R0256:Arg1'
ID34745
Institutional Source Beutler Lab
Gene Symbol Arg1
Ensembl Gene ENSMUSG00000019987
Gene Namearginase, liver
SynonymsPGIF, AI, Arg-1
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R0256 (G1)
Quality Score166
Status Validated
Chromosome10
Chromosomal Location24915221-24927484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24916458 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 188 (Y188H)
Ref Sequence ENSEMBL: ENSMUSP00000020161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020161
AA Change: Y188H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987
AA Change: Y188H

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218260
Meta Mutation Damage Score 0.1173 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele show postnatal lethality, hyperammonemia, argininemia, altered plasma levels of other amino acids, enlarged pale livers, and abnormal hepatocytes. Mice homozygous for a different null allele show postnatal lethality, andincreased macrophage nitric oxide production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Cdh6 T C 15: 13,053,782 probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Fhl5 T C 4: 25,213,624 H104R probably benign Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr813 A T 10: 129,857,037 D173V probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Ror1 T A 4: 100,409,745 H214Q probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Sval3 A G 6: 41,972,905 D122G probably damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Arg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02011:Arg1 APN 10 24916377 missense probably benign 0.00
IGL02889:Arg1 APN 10 24915755 missense probably damaging 0.98
R0180:Arg1 UTSW 10 24916830 missense probably benign
R0588:Arg1 UTSW 10 24920624 missense probably damaging 1.00
R1014:Arg1 UTSW 10 24916860 missense probably benign
R1327:Arg1 UTSW 10 24920804 splice site probably null
R1965:Arg1 UTSW 10 24916864 splice site probably null
R2071:Arg1 UTSW 10 24922663 missense probably benign 0.00
R2118:Arg1 UTSW 10 24920723 missense possibly damaging 0.58
R4158:Arg1 UTSW 10 24922677 missense probably damaging 1.00
R4858:Arg1 UTSW 10 24922638 missense possibly damaging 0.73
R5741:Arg1 UTSW 10 24917999 missense probably benign
R5793:Arg1 UTSW 10 24920642 missense probably benign 0.36
R7453:Arg1 UTSW 10 24915776 missense probably damaging 1.00
R7634:Arg1 UTSW 10 24915729 missense possibly damaging 0.46
R7760:Arg1 UTSW 10 24927463 start gained probably benign
R7803:Arg1 UTSW 10 24916791 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGAGGGGCTTTCAGCTTAAAGTG -3'
(R):5'- GACTCCCTGCATATCTGCCAAAGAC -3'

Sequencing Primer
(F):5'- GGTCTGACCCTGCATTATAAAAGC -3'
(R):5'- GCATATCTGCCAAAGACATCGTG -3'
Posted On2013-05-09