Incidental Mutation 'R0256:Olfr813'
ID34747
Institutional Source Beutler Lab
Gene Symbol Olfr813
Ensembl Gene ENSMUSG00000052818
Gene Nameolfactory receptor 813
SynonymsMOR108-3, GA_x6K02T2PULF-11535078-11536010
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0256 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129855367-129858722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129857037 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 173 (D173V)
Ref Sequence ENSEMBL: ENSMUSP00000145260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064893] [ENSMUST00000204622]
Predicted Effect probably damaging
Transcript: ENSMUST00000064893
AA Change: D173V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063431
Gene: ENSMUSG00000052818
AA Change: D173V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-49 PFAM
Pfam:7tm_1 39 288 3.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204622
AA Change: D173V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: D173V

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Meta Mutation Damage Score 0.8591 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Arg1 A G 10: 24,916,458 Y188H probably benign Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Cdh6 T C 15: 13,053,782 probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Fhl5 T C 4: 25,213,624 H104R probably benign Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Ror1 T A 4: 100,409,745 H214Q probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Sval3 A G 6: 41,972,905 D122G probably damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Olfr813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Olfr813 APN 10 129856628 missense probably benign 0.00
IGL01650:Olfr813 APN 10 129857067 missense probably damaging 1.00
IGL01734:Olfr813 APN 10 129856802 missense probably benign 0.36
IGL01909:Olfr813 APN 10 129857081 missense probably damaging 0.99
R0607:Olfr813 UTSW 10 129857201 missense possibly damaging 0.67
R0924:Olfr813 UTSW 10 129856646 missense probably damaging 1.00
R1345:Olfr813 UTSW 10 129856890 missense probably damaging 1.00
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R2344:Olfr813 UTSW 10 129856541 missense probably benign 0.01
R3851:Olfr813 UTSW 10 129857147 missense probably benign 0.00
R4486:Olfr813 UTSW 10 129856698 missense probably damaging 1.00
R4934:Olfr813 UTSW 10 129857027 missense possibly damaging 0.91
R5397:Olfr813 UTSW 10 129856710 missense probably damaging 1.00
R5644:Olfr813 UTSW 10 129857427 missense probably benign 0.38
R5925:Olfr813 UTSW 10 129856875 missense probably damaging 1.00
R6224:Olfr813 UTSW 10 129857192 missense probably benign 0.17
R7839:Olfr813 UTSW 10 129857030 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTGCAAGCCTCTGCACTATACAACC -3'
(R):5'- TCCAGCCTTGGCAGATGTTTTCAC -3'

Sequencing Primer
(F):5'- CATCATCAGTAACAAGATCTGCC -3'
(R):5'- CATGAAGATGCAGCTTCCATAG -3'
Posted On2013-05-09